Loop-Mediated Isothermal Amplification Integrated
Loop-Mediated Isothermal Ampli?cation Integrated on Micro?uidic Chips for Point-of-Care Quantitative Detection of Pathogens
Xueen Fang,?,?Yingyi Liu,?Jilie Kong,*,?and Xingyu Jiang*,?
Department of Chemistry and Institutes of Biomedical Sciences,Fudan University,Shanghai200433,P.R.China,and CAS Key Lab for Biological Effects of Nanomaterials and Nanosafety,National Center for Nanoscience and Technology,Beijing100190,P.R.China
This work shows that loop-mediated isothermal ampli?ca-tion(LAMP)of nucleic acid can be integrated in an eight-channel micro?uidic chip for readout either by the naked eye(as a result of the insoluble byproduct pyrophosphate generating during LAMP ampli?cation)or via absorbance measured by an optic sensor;we call this system micro-LAMP(μLAMP).It is capable of analyzing target nucleic acids quantitatively with high sensitivity and speci?city. The assay is straightforward in manipulation.It requires a sample volume of0.4μL and is complete within1h. The sensitivity of the assay is comparable to standard methods,where10fg of DNA sample could be detected under isothermal conditions(63°C).A real time quan-titativeμLAMP assay using absorbance detection is pos-sible by integration of optical?bers within the chip.
Pseudorabies virus(PRV)is the main pathogen of pseudora-bies,which would infect pigs with high mortality.Effective PRV detection is very important in the surveillance and control of the acute infectious disease.Traditional methods for PRV detection includes virus isolation,immunohistological assays,and various polymerase chain reactions(PCRs),which either consume unac-ceptably long time or demand sophisticated instruments for routine and large-scale assays or point-of-care detection.
Loop-mediated isothermal ampli?cation(LAMP)is a method for the ampli?cation of nucleic acids,which ampli?es DNA/RNA under isothermal conditions(60-65°C)with high speci?city and sensitivity using a set of six specially designed primers and a Bst DNA polymerase.1Without the need to accurately toggle the reaction mixture between different temperatures normally re-quired for PCR,LAMP is a powerful tool for nucleic acid ampli?cation and it has already been used widely in pathogen detection,such as human immunode?ciency virus(HIV),2severe acute respiratory syndrome coronavirus(SARS-CoV),3hepatitis B virus(HBV),4H5avian in?uenza virus,5and so forth.Although LAMP is more convenient and effective than technologies based on pathogen isolation,immunoassays,and PCRs,most of the methods for monitoring the process of LAMP are performed in macroscale tubes,often requiring at least tens to hundreds of microliters of solutions in polypropylene tubes,which severely limits the throughput/miniaturization of LAMP and the incorpora-tion of LAMP into automated and integrated diagnostic systems.
Recent developments in micro?uidics technology have enabled applications related to lab-on-a-chip or micrototal analysis systems. They allow the manipulation of small volumes of liquids in microfabricated channels and in some cases microchannels to perform all analytical steps including sample pretreatment,reac-tion,separation,and detection on a small chip in an effective and automatic format.6-8Micro?uidics has been applied in many biological assays,such as electrophoresis,9immunoassays,10-14 nucleic acid ampli?cation analysis,15-17cell manipulations18-21and
*To whom correspondence should be addressed.E-mail:xingyujiang@ https://www.sodocs.net/doc/0419387204.html,(X.J.);jlkong@https://www.sodocs.net/doc/0419387204.html,(J.K.).
?Fudan University.
?National Center for Nanoscience and Technology.
(1)Notomi,T.;Okayama,H.;Masubuchi,H.Nucleic Acids Res.2000,28,E63.
(2)Curtis,K.A.;Rudolph,D.L.;Owen,S.M.J.Virol.Methods2008,151,
264–270.
(3)Hong,T.C.;Mai,Q.L.;Cuong,D.V.J.Clin.Microbiol.2004,4,1956–
1961.
(4)Cai,T.;Lou,G.Q.;Yang,J.;Xu,D.;Meng,Z.H.J.Clin.Virol.2008,41,
270–276.
(5)Imai,M.;Ninomiya,A.;Minekawa,H.;Notomi,T.;Ishizaki,T.;Tashiro,
M.;Odagiri,T.Vaccine2006,24,6679–6682.
(6)Zheng,B.;Ismagilov,R.F.Angew.Chem.,Int.Ed.2005,44,2520–2523.
(7)Whitesides,G.M.Nature2006,442,368–373.
(8)Wang,J.B.;Zhou,Y.;Qiu,H.W.;Huang,H.;Sun,C.H.;Xi,J.Z.;Huang,
https://www.sodocs.net/doc/0419387204.html,b Chip2009,9,1831–1835.
(9)Manz,A.;Harrison,D.J.;Verpoorte,E.M.J.;Fettinger,J.C.;Paulus,A.;
Lu¨di,H.;Wider,H.M.J.Chromatogr.1992,593,253–258.
(10)Jiang,X.Y.;Ng,J.M.K.;Stroock,A.D.;Dertinger,S.K.W.;Whitesides,
G.M.J.Am.Chem.Soc.2003,125,5294–5295.
(11)Yang,D.Y.;Niu,X.;Liu,Y.Y.;Wang,Y.;Gu,X.;Song,L.S.;Zhao,R.;Ma,
L.Y.;Shao,Y.M.;Jiang,X.Y.Adv.Mater.2008,20,4770–4775. (12)Liu,Y.Y.;Yang,D.Y.;Yu,T.;Jiang,X.Y.Electrophoresis2009,30,3269–
3275.
(13)Shi,M.H.;Peng,Y.Y.;Zhou,J.;Liu,B.H.;Huang,Y.P.;Kong,J.L.Biosens.
Bioelectron.2007,22,2841–2847.
(14)Chen,H.;Jiang,C.M.;Yu,C.;Zhang,S.;Liu,B.H.;Kong,J.L.Biosens.
Bioelectron.2009,24,3399–3411.
(15)Northrup,M.A.;Ching,M.T.;White,R.M.;Watson,R.T.Proc.Tranducers
1993,924–926.
(16)Schaerli,Y.;Wootton,R.C.;Robinson,T.;Stein,V.;Dunsby,C.;Neil,
M.A.A.;French,P.M.W.;deMello,A.J.;Abell,C.;Hollfelder,F.Anal.
Chem.2009,81,302–306.
(17)Huang,Y.Y.;Castrataro,P.;Lee,C.C.;Quake,https://www.sodocs.net/doc/0419387204.html,b Chip2007,7,
24–26.
(18)Sun,Y.;Liu,Y.Y.;Qu,W.S.;Jiang,X.Y.Anal.Chim.Acta2009,650,
98–105.
(19)Chen,Z.L.;Li,Y.;Liu,W.W.;Zhang,D.Z.;Zhao,Y.Y.;Yuan,B.;Jiang,
X.Y.Angew.Chem.,Int.Ed.2009,48,8303–8305.
(20)Chen,Z.;Xie,S.B.;Shen,L.;Du,Y.;He,S.I.;Li,Q.;Liang,Z.W.;Meng,
X.;Li,B.;Xu,X.D.;Ma,H.W.;Huang,Y.Y.;Shao,Y.H.Analyst2008, 133,1221–1228.
Anal.Chem.2010,82,3002–3006
10.1021/ac1000652 2010American Chemical Society 3002Analytical Chemistry,Vol.82,No.7,April1,2010
Published on Web03/10/2010
so forth.Among these assays,nucleic acid ampli?cation-based micro?uidics is an active research https://www.sodocs.net/doc/0419387204.html,bination of LAMP and micro?uidic technology will miniaturize the LAMP detection system and facilitate the realization of point-of-care(POC)patho-gen detection.
In this study,we integrate the LAMP on a micro?uidic chip, which we call microLAMP(μLAMP)to quantitatively detect target nucleic acids with high sensitivity,speci?city,and rapidity.This device potentially enables LAMP assays to be highly portable for on-site analysis.
MATERIALS AND METHODS
Materials.Pseudorabies virus(PRV)derived from cell culture was provided by the Shanghai Entry-Exit Inspection and Quar-antine Bureau(SHCIQ).Total PRV genomic DNA used as the positive model was extracted using the QlAamp DNA Blood Mini Kit(Qiagen GmbH,Germany).This virus was used as the model for the development of theμLAMP assay for the following reasons: (1)as a real world virus,this model is more complex and challenging than a synthetic sequence of nucleic acids and(2) the surveillance of PRV is particularly important in countries(e.g., China)where pork is the predominant source of meat.
Micro?uidic Chip Design and Fabrication.A poly(dimeth-ylsiloxane)(PDMS)master with positive surface patterns was molded against a60mm×60mm poly(methyl methacrylate) (PMMA)glass fabricated by mechanical microfabrication.The PDMS replica was produced by soft lithography as the following: 19The PDMS precursor mixture prepared at a weight ratio of base to curing agent of10:1was poured carefully on the master, placed under vacuum for～0.5h to rid the bubbles,and cured at 80°C for2h.The cured PDMS replica was gently peeled off the master,and the conically shaped inlet/outlet was drilled manually using a knife.(This kind of inlet/outlet was necessary for the con-venient and accurate addition of the DNA sample and at the same time making the capillary force available to transport the LAMP reaction mixture into microchannel.)Finally,the replica was irreversibly sealed with a microscope glass slide by an O2plasma to form a leak-proofμLAMP microchannel.The?nal dimension of the microchannel is1mm×0.8mm×0.6mm with a volume of～5μL.
Setup for Real-Time Quantitative Analysis.A detection length of1.2mm was used in the real-time turbidity absorbance detection system while the volume of the microchannel remained to be5μL.The optical detection unit including optical?bers(FU-76F,Keyence Corporation,Osaka,Japan)and digital?ber optic sensor(FS-V31M,Keyence Corporation,Osaka)were applied in our system.The?ber optic sensor employs a high-intensity red light-emitting diode(LED)light at640nm and a phototransistor. The launching and collecting optical?bers with a265μm diameter core and400μm diameter cladding were inserted carefully into the?ber channels that oppose each other.The reduction of optical density was used to indicate the turbidity generation of the LAMP reaction:22,23
optical density)ln(I
/I
1
)=turbidity
where I0is the intensity of incident light and I1is the intensity of transmitted light.Serial dilutions(10-fold)of PRV DNA ranging from105to10fg/μL were used as templates to evaluate the dynamics of LAMP ampli?cation in micro?uidic chips and establish standard curves for quantitative analysis.
LAMP Ampli?cation.The LAMP reaction was performed according to our previous work with minor modi?cation.24The whole volume of the system was5μL,which contained1×ThermoPol buffer(New England Biolabs Inc.),8.0mM MgSO4, 0.8M betaine(Sigma,Germany),1.0mM dNTPs(Invitrogen), 0.2μM each of the outer primer(F3,CGCCTTCCTGCAC-TACG;B3,AGCGGGCCGTTGAAGA),1.6μM each of inner primer(FIP,AGAGGTGCACGGGGTAGAGCGGGCACGGT-GTCCATC AA;BIP,GGACGTCAACCGGCTCGTGG CGCGGG-TACACAAACTCCT),and0.8μM each of loop primer(LF, ACGCGCCACGCCTCGTGC;LB,CGACCCCTTCAACG CCAA), 0.32U/μL of Bst polymerase(large fragment;New England Biolabs Inc.)with0.4μL of nucleic acid sample as a template. The ampli?cation was performed at63°C in a laboratory water bath for1h.The detection result was determined directly by the naked eye or a?ber optic sensor according to the turbidity of the solution during LAMP ampli?cation,which was then con?rmed by agarose gel electrophoresis and restriction digestion with the Hinc II enzyme.
Integrated Micro?uidic LAMP Chip Operation.A sample containing0.4μL of nucleic acid was?rst introduced via the inlet.
A reaction mixture for LAMP(prepared manually according to the system above)of4.6μL was drawn slowly into the micro-channel by capillary force.The inlet and outlet were tightly sealed by uncured PDMS to form an integral microchamber for LAMP reaction.The whole micro?uidic chip was incubated at63°C for 1h using a water bath.The?nal results were analyzed by the naked eye or optical absorbance and con?rmed by agarose gel electrophoresis.The presence of0.1%Triton X-100in the reaction mixture and the hydrophilicity of the PDMS replica(as a result of O2plasma treatment)could help completely?ll the micro-chamber without trapped air.25
RESULTS AND DISCUSSION
Fabrication of Microchips forμLAMP.We constructed a PDMS-glass hybrid micro?uidic chip with eight5μL microchan-nels(Figure1).The micro?uidic chip is easy to fabricate without using any precise valves or pumps.The LAMP reaction and readout could be simultaneously performed on the microchip.We prevented typical problems associated with the failure of DNA ampli?cation in microchannels,such as bubble generation,reagent evaporation,cross contamination,by completely?lling and sealing the microchamber with uncured PDMS in the conically shaped inlet/outlet while taking care to prevent entrapped gas.This method precludes any of the frequently encountered problems reported by researchers designing nucleic ampli?cation micro-channels.26These advantages ofμLAMP are most likely due to
(21)Go′mez-Sjo¨berg,R.;Leyrat,A.A.;Pirone,D.M.;Chen,C.S.;Quake,S.R.
Anal.Chem.2007,79,8557–8563.
(22)Mori,Y.;Kitao,M.;Tomita,N.;Notomi,T.J.Biochem.Biophys.Methods
2004,59,145–157.
(23)Lee,S.Y.;Huang,J.G.;Chuang,T.L.;Sheu,J.C.;Chuan,Y.K.;Holl,M.;
Meldrum,D.R.;Lee,C.N.;Lin,C.W.Sens.Actuators,B2008,133,493–501.(24)Fang,X.E.;Xiong,W.;Li,J.;Chen,Q.J.Virol.Methods2008,151,35–39.
(25)Ramalingam,N.;San,T.C.;Kai,T.J.;Mak,M.Y.M.;Gong,H.Q.
Micro?uid.Nano?uid.2009,7,325–336.
(26)Shin,Y.S.;Cho,K.;Lim,S.H.;Chung,S.;Park,S.J.;Chung,C.;Han,
D.C.;Chang,J.K.J.Micromech.Microeng.2003,13,768–774.
3003 Analytical Chemistry,Vol.82,No.7,April1,2010
the fact that μLAMP does not require changes in temperature,a protocol that may bring about problems such as bubble generation in PDMS.In this respect,μLAMP is particularly compatible with PDMS.
As an isothermal DNA ampli?cation device,our μLAMP chip did not require a precise thermal cycling module.A water bath or heat block alone was suf?cient for performing the μLAMP,which would be more acceptable in resource-poor settings.Sensitivity and Speci?city of the μLAMP.During LAMP ampli?cation,a large amount of byproduct,a white precipitate of magnesium pyrophosphate,appears,leading to a turbid reaction mixture,which could be directly observed by the naked eye.27We incorporated this visual detection method in the μLAMP system.Such visual detection often suffers from low sensitivity in microchan-nels because of the short optical length.Lee et al.demonstrated the necessity of at least a volume of 25μL in the microchamber for the turbidity detection.Zhang et al.presented a 10μL volume LAMP microchamber for visual determination.28In our system,we designed an optical length of 800μm for turbidity detection of μLAMP while the reaction volume was reduced to 5μL.The sensitivity of the μLAMP was evaluated by the naked eye visual analysis and standard agarose gel electrophoresis using a series of PRV DNA dilutions (10-2to 10-8)as templates (original concentration of DNA sample was 10ng/μL).We observed that the detection limit of the assay was 10fg of DNA,100-1000-fold more sensitive than the standard PCRs for PRV detection (Figure 2).24The high sensitivity of our system was possibly attributable to the merits of Bst polymerase and loop-mediated mechanism of the ampli?cation.1Otherwise,the turbidity in the microchannels did not decrease simultaneously with reduction of the initial DNA copies,which made the naked eye detection more powerful and effective (Figure 2A).
To demonstrate the speci?city of μLAMP,we applied a Hinc II restriction enzyme digestion assay.24Products of a band of predict-able size of ～108bp were resolved on the gel after the Hinc II enzyme digestion assay,demonstrating that the target region of the nucleic acid was ampli?ed speci?cally (Figure 3B,lane 2).To validate the speci?city of μLAMP for PRV,we used viruses not targeted by the LAMP primers,namely,foot-and-mouth disease virus (FMDV),transmissible gastroenteritis of swine virus (TGEV),and porcine parvovirus (PPV)as control experiments.The result shows that μLAMP is highly speci?c and does not bring about cross-reaction from nontargeted viruses (Figure 3A).Moreover,the speci?city of LAMP can be con?rmed by the ladderlike pattern observed in gel electrophoresis (Figure 3B,lane 1).1,27
Because of the very weak turbid signal of LAMP in the traditional PCR tube,many groups have developed other detection methods in recent years,such as various DNA staining methods,?uorescent LAMP primers,30?uorescent metal indicators,31and so forth.These methods typically rely on either complex equip-ment or sophisticated chemical synthesis.We can,however,easily observe the turbidity in the microchamber with the naked eye alone,which makes μLAMP suitable for integration into complex systems designed to be in a lab-on-a-chip format without having to resort to bulky equipments required in many complex methods.We ascribe the strong turbid signal in the microchamber to its larger depth-to-width ratio (DWR of the microchamber in our μLAMP and a typical PCR tube was 1.33and 1.00,respectively).In a word,the μLAMP established in our study using the direct naked eye detection was highly sensitive,speci?c,and could be
(27)Mori,Y.;Nagamine,K.;Tomita,N.;Notomi,T.Biochem.Biophys.Res.
Commun.2001,289,150–154.
(28)Hataoka,Y.;Zhang,L.H.;Mori,Y.;Tomita,N.;Notomi,T.;Baba,Y.Anal.
Chem.2004,76,3689–3693.
(29)Vanoirschot,J.T.J.Clin.Microbiol.1991,5–9.
(30)Mori,Y.;Hirano,T.;Notomi,T.BMC Biotechnol.2006,6,3.
(31)Tomita,N.;Mori,Y.;Kanda,H.;Notomi,T.Nat.Protoc.2008,3,877–
882
.
Figure 1.Eight-channel PDMS -glass hybrid micro?uidic chip for LAMP:(A)photograph and (B)schematic drawing of an eight-channel PDMS -glass hybrid micro?uidic
chip.
Figure 2.Sensitivity of the μLAMP:(A)direct naked eye detection.Channels 1-5show the white precipitate (channels appear white),while channels 6-8do not (channels appear dark).(B)Sensitivity of the LAMP determined by standard agarose gel electrophoresis.(1-7)DNA sample located at 10-2(105fg/μL),10-3(104fg/μL),...0.10-7(0.1fg/μL)dilutions,respectively,and (8)negative
control.
Figure 3.The speci?city of the μLAMP:(A)speci?city of the μLAMP determined by nontargetted viruses;(1-5)PRV,FMDV,TGEV,PPV,and negative control,respectively.(B)The speci?c ampli?cation con?rmed by the Hinc II enzyme;(M)DL2000DNA marker,(1)ladderlike bands of μLAMP,(2)product of a band of predictable size of ～108bp determined by the Hinc II assay,(3)negative control.
3004Analytical Chemistry,Vol.82,No.7,April 1,2010
conducted together with the ampli?cation in one step without using any detection reagents or equipment.The notable merits of the μLAMP were compared with other methods,including polymerase chain reaction (PCR),enzyme-linked immunosorbant assay (ELISA),and direct virus isolation assay,which were demonstrated in Table 1.We believe that this method has great potential for developing point-of-care devices.
μLAMP for Quantitative Analysis.To further show that μLAMP can be easily expanded for more sophisticated assays,we demonstrate that the μLAMP system could also be applied for the quantitative analysis via measuring the absorbance of the reaction mixture.Absorbance assay is a ?exible and robust technology commonly used in micro?uidic chips.32Because of the generation of turbidity in LAMP reaction,we performed the turbidity absorbance detection by integrating optical ?bers in the micro?uidic chip to realize real-time monitoring of the LAMP process and its quantitative analysis.We applied a single channel optical detection module with a 1.2mm detection length to develop the quantitative μLAMP (Figure 4).
We obtained values of threshold time (Tt,de?ned as the reaction time necessary for samples to reach suf?ciently positive signals above the baseline during real-time ampli?cation)of μLAMP by measuring https://www.sodocs.net/doc/0419387204.html,MPs from different initial concentrations of DNA template had different values of Tt,which can be related to the initial DNA concentration.Tt could be obtained by monitoring absorbance,which changes in real time as a result of the accumulation of precipitates.22We used serial dilutions (10-fold)of DNA templates from 105to 10fg/μL to generate standard dynamic curves by the optical μLAMP chip system and corresponding Tt values (Figure 5A).The log linear regression plot between template concentration and Tt shows a correlation coef?cient of 0.9894,making the ?ber optical μLAMP chip useful for quantitative DNA analysis (Figure 5B).
From the results shown in Figure 5,The LAMP ampli?cation from the lowest sample concentration (10fg/μL DNA)initiated a positive response at 46min and then proceeded rapidly at an approximate exponential rate,reaching a maximum at 50min.Experiments with high initial DNA concentrations exhibited fast positive responses in reaching the maximum.All curves decreased slightly after the maximum time.We attribute this observation to the following reasons:(1)precipitation and aggregation of magnesium pyrophosphate and (2)adsorption of pyrophosphates on the microchannel surface.This decay in turbidity absorbance does not affect the accuracy of the quantitative analysis because of the prominence of the emergence of the Tt.
Compared with other known methods for detecting viruses,μLAMP is relatively fast,and virus isolation 33and immunohisto-logical methods 34for detecting PRV are both time-consuming,requiring at least 2-3days,while PCR assays also required 2-3h to ?nish the ampli?cation.35-37By contrast,in our system,LAMPs from detectable DNA samples could all be accomplished within 60min (with higher concentrations of samples requiring even less time,see Figure 5.This time was comparably short among various methods.The whole diagnostic process from the sample arrival to the ?nal result readout could be accomplished within less than 2h.
Although ?uctuations could not be avoided between runs in this homemade single channel optical detection system,the emergence of new technologies,such as integrated optical waveguides in micro?uidics or opto?uidics,may bring us the hope
(32)Myers,F.B.;Lee,https://www.sodocs.net/doc/0419387204.html,b Chip 2008,8,2015–2031.
(33)Pensaert,M.B.;Kluge,J.P.In Virus Infections of Porcines ;Pensaert,M.B.,
Ed.;Elsevier:Amsterdam,The Netherlands,1989;pp 39-65.
(34)Ducatelle,R.;Coussement,W.;Hoorens,J.Res.Vet.Sci.1982,32,294–
302.
(35)Osorio, F. A.In First International Symposium on the Eradication of
Pseudorabies Aujeszky’s Disease Virus ;Morrison,R.B.,Ed.;Elsevier:Saint Paul,MN 1991;pp 17-32.
(36)Balasch,M.J.;Segale,P.J.Vet.Microbiol.1998,60,99–106.
(37)Lee,C.S.;Moon,H.J.;Yang,J.S.J.Virol.Methods 2007,139,39–43.
Table 1.Merits of μLAMP Compared with Other Techniques
methods
sensitivity speci?city sample time
equipment
μLAMP 10fg/μL high 0.4μL 0.5-1h water bath PCR 24103fg/μL high 2μL 1.5-2h thermocycler ELISA 29
～103fg/μL low 2μL 2-3h ELISA reader neutralization 29,32,33
low
high
～50μL
3days
biosafety
lab
Figure 4.Photograph (A)and schematic illustration (B)of the quantitative analysis
unit.
Figure 5.Results from the optical absorbance assay:dynamic curves (A)and standard curve (B)of the real-time absorbance detection of the LAMP chip.
3005
Analytical Chemistry,Vol.82,No.7,April 1,2010
in realizing multichannel detection,which may achieve increas-ingly accurate real-time quantitative analysis in one experiment.38,39 The combination of the turbidity-based readout of LAMP and the optical?ber incorporation in the micro?uidic chip would be an attractive area and bring us a fascinating future to achieve a POC quantitative nucleic acid analytical device which could be used to survey and combat epidemics,such as SARS,tuberculosis,or in?uenza A(H1N1)and so forth.
CONCLUSIONS
In this study,we integrated an isothermal DNA ampli?cation, LAMP,on a micro?uidic chip and fabricated a multichannel micro?uidic system for parallel detection of pathogens.The readout could either be a naked-eye determination or a compact real-time absorbance detection device.TheμLAMP presented here allows the direct analysis of a sample of0.4μL of interested DNA in less than1h with a detection limit of10fg/μL.
The combination of LAMP and micro?uidics will perform diagnostics in a parallel,multiple,high-throughput,and integrated format.The technology presented here will eventually facilitate the realization of POC devices that can be used anywhere,by anyone to assay for agents that are associated with epidemics.
ACKNOWLEDGMENT
We are grateful for the kind help from the colleagues in our groups,particularly Wanshun Ma for his help in chip fabrication and Wenying Pan,Bo Yuan,and Yi Zhang for their assistance in image illustration.We thank Dr.Hui Chen for her helpful advice in the manuscript revision.We acknowledge the National Science Foundation of China(2Grants0945001,20890020,20890022, 2009ZX10605,and90813032),the Human Frontier Science Pro-gram,the Chinese Academy of Sciences(Grant KJCX2-YW-M15), and the Ministry of Science&Technology(Grants2007CB714502, 2009CB930001,and2009ZX10004-505)for?nancial support.
Received for review January9,2010.Accepted March3, 2010.
AC1000652
(38)Balslev,S.;Jorgensen,A.M.;Bilenberg,B.;Mogensen,K.B.;Snakenborg,
D.;Geschke,O.;Kutter,J.P.;Kristensen,https://www.sodocs.net/doc/0419387204.html,b Chip2006,6,213–217.
(39)Keea,J.S.;Poenarb,D.P.;Neuzil,P.;Yobas,L.Sens.Actuators,B2008,
134,532–538.
3006Analytical Chemistry,Vol.82,No.7,April1,2010