当前位置：搜档网 › Cloning and characterization of a pentatricopeptide protein encoding gene

Cloning and characterization of a pentatricopeptide protein encoding gene

(LOJ )that is specifically expressed in lateral organ junctions in

Arabidopsis thaliana

Anand Mohan Prasad,C.Sivanandan,Radhamony Resminath,

Dhiraj R.Thakare,S.R.Bhat,Srinivasan *

National Research Centre on Plant Biotechnology,Indian Agricultural Research Institute,New Delhi 110012,India

Received 26October 2004;received in revised form 15February 2005;accepted 22March 2005

Received by B.Hohn

Abstract

A line exhibiting expression of h -glucuronidase (GUS)in the lateral organ junctions and shoot apical meristem (SAM)was identified from a population of T-DNA tagged lines carrying a promoterless GUS gene.Southern hybridization confirmed the presence of a single T-DNA insertion in this line.The plant sequences flanking the T-DNA were cloned by TAIL PCR and sequenced.The insertion of T-DNA was found to be in the upstream region of a hypothetical gene (At2g39230).This gene,which we term as LOJ to indicate its specific expression in all lateral organ junctions encodes a predicted protein containing pentatricopeptide (PPR)motifs.This gene appears to belong to a group of TATA-less promoters and codes for a long ORF without any intron.The gene apparently codes for a protein of 97.65kD with a mitochondrial target sequence at the N-terminal.Transcript analysis revealed that the expression of the gene is specifically restricted to the lateral organ junctions throughout the life of the plants.5V RACE analysis revealed a 95nucleotide long UTR region for this hypothetical gene.In silico analysis of the upstream region failed to identify a TATA box within à146nucleotides.GUS expression analysis of the line 149and the transgenic plants generated with constructs carrying the upstream sequences of this gene fused to uid A identified that the specificity of the expression of this gene resides within à569to à152bp region.The specific expression of LOJ at the base of lateral organ and shoot apical meristem (SAM)suggests an important role of LOJ in lateral organ development and boundary demarcation.D 2005Elsevier B.V .All rights reserved.

Keywords:Insertional mutagenesis;T-DNA;PPR;Shoot apical meristem;Tissue specific promoter

1.Introduction

Among a variety of approaches available to identify new genes and promoters in plant systems,promoter trap insertional mutagenesis strategy has become very popular in Arabidopsis thaliana (Ostergaard and Yanofsky,2004)due to the ease of transformation technology in this plant.

This method relies on the activation of a promoterless reporter gene upon insertion next to a functional promoter sequence.Further,this method is ideally suited for the identification of functionally redundant genes that would not be detectable in a conventional mutational screen (Wei et al.,1997).

By this strategy,we identified a T-DNA tagged line (line 149)in which the reporter gene GUS was found to express at the junction of lateral organs.A number of genes/promoters expressing in similar fashion have been reported earlier.These include Petunia No Apical Meristem (NAM),CUP-SHAPED COTYLEDON genes (CUC1,CUC2,CUC3),CUPULIFORMIS and LATERAL ORGAN BOUN-DARIES (LOB )genes (Souer et al.,1996;Aida et al.,1997;

Abbreviations:LOJ ,lateral organ junction;GUS,h -glucuronidase;PPR,pentatricopeptide;RT-PCR,reverse transcription polymerase chain reaction;SAM,shoot apical meristem;RACE,rapid amplification of cDNA ends.

*Corresponding author.Tel.:+911125841787;fax:+911125843984.E-mail address:sri@iari.res.in (Srinivasan).Gene 353(2005)67–

https://www.sodocs.net/doc/6718373135.html,/locate/gene

Takada et al.,2001;Shuai et al.,2002;Vroemen et al.,2003; Weir et al.,2004).While,nam,cuc3,cuc1cuc2double mutant and cuc3and cuc1,and/or cuc2mutant combina-tions have fused cotyledons(Souer et al.,1996;Aida et al., 1997;Takada et al.,2001;Vroemen et al.,2003)and cup mutants also have cotyledon and floral organ fusions(Weir et al.,2004).The gene disruption of some other genes like CUC1,CUC2and LOB exhibits no morphological pheno-type.Line149identified by us also did not result in any visible mutant phenotype and the plants were indistinguish-able from the wild type.We chose to study this line in detail to identify the gene and promoter region.Here we report the identification of a new gene designated as LOJ,which expresses specifically in lateral organ junctions.LOJ belongs to PPR family of genes(Small and Peeters,2000) and shows mitochondrial targeting signal sequences.Fur-ther,the analysis of the upstream region of LOJ using GUS fusion constructs revealed that the expression specificity lies within664bp upstream of the start codon of LOJ.The available promoter prediction software(PlantDB database) failed to identify promoter in the750bp5V region of LOJ.In silico analysis of the upstream region by different softwares also failed to identify a TATA box withinà146nucleotides. Thus,this study has identified a unique TATA-less promoter,which is different from earlier identified monocot, or dicot plant promoters.Further,our work for the first time implicates a PPR protein in the lateral organ development and boundary formation.

2.Material and methods

2.1.Plant material and growth condition

A.thaliana ecotype Columbia was used.Seeds were surface sterilized with0.1%SDS–HgCl2and inoculated on Petri plates containing0.8%agar-gelled Murashige and Skoog medium(Murashige and Skoog,1962)supplemented with2%sucrose and0.1%MES(2–N–(morpholino)ethane sulfonic acid)and then kept at4-C for3days to break the dormancy.The plants were then incubated at23-C temper-ature and16h photoperiod(150A mol/m2/s)(Feldmann and Marks,1987).The10-day-old seedlings were transferred to pots and grown in growth chamber.

2.2.Bacterial strains and plasmids

A promoter trap vector pCS1constructed in our lab (Sivanandan,2004)was mobilized into Agrobacterium strain GV3101(Koncz and Schell,1986)by freeze-thaw method and used for all plant transformations.The T-DNA of this vector contains the Bar gene encoding phosphino-thricin acetyl transferase as the plant selectable marker that confers resistance to the herbicide Basta and carries a promoterless GUS reporter gene close to the right border of the T-DNA.2.3.Transformation and screening

The Columbia ecotype of A.thaliana was used to generate T-DNA insertion lines.Plants were grown in soil at23-C under long day condition(16h light and8h dark)and transformed by the floral dip protocol(Clough and Bent, 1998).The seeds harvested from T0plants were surface sterilized and sown on MS medium containing6mg/l Basta and then kept at4-C for3days to break dormancy and then transferred to culture room maintained at required growth conditions as mentioned earlier.The12-to15-day-old green seedlings were transplanted to pots containing Soilrite and grown at23-C in a greenhouse(16h light and8h dark). Transformants were allowed to self-fertilize and T2seeds were collected separately from each T1plants.

2.4.Plant DNA preparation and PCR amplification

All the primers used in the present study are listed in Table1.

Total genomic DNA was extracted from plants selected on Basta using DNA extraction kit(Qiagen)as per manu-facturer’s protocol.50ng of DNA from T1plants was used as template for PCR analysis.GUS forward/GUS reverse and Bar forward/Bar reverse primer sets were used in a32cycle PCR(94-C/30s;57-C/1min;and72-C/2min)to verify the presence of T-DNA in the transformants.Plants that were PCR positive,for the presence of both the genes,were selected for further analysis.

Suitable primer sets homologous to the plant genome sequences flanking the right and left borders(JPR1/JPR2) and that present in the insert(TR1/JPR3)were not only used to identify the insertional mutants but also to distinguish be-tween plants homozygous and heterozygous for the insertion.

2.5.Histochemical localization of GUS activity and microscopy

Plant tissues were stained for GUS activity in5-bromo-4-chloro-3-indolyl-h-glucuronic acid(X-gluc)as described by Jefferson et al.(1987).GUS expression in parts of4-week-old T2seedlings was analyzed.GUS stained6-day-old seedlings of line l49were processed for sectioning as previously described(Springer et al.,2000).

2.6.Genomic Southern blot analysis

A total of5A g of genomic DNA was digested with restriction endonucleases Eco RI,Hin dIII and Nde I,electro-phoresed in0.8%agarose gel(Sambrook et al.,1989)and blotted on to Hybond N+(Amersham)nylon membrane (Southern,1975).The probe for hybridization was prepared from PCR amplified products(primer set,GUS500F/GUS reverse)of GUS gene coding region from pCS1plasmid. Hexa Label Plus TM DNA labeling kit(MBI Fermentas)was used to radiolabel the DNA fragment with a32P-dCTP.

A.M.Prasad et al./Gene353(2005)67–79 68

2.7.TAIL PCR amplification of T-DNA flanking sequences

The DNA sample of line149was used to amplify plant genome sequences flanking the T-DNA by TAIL PCR as previously described(Liu et al.,1995).A set of specific nested primers complementary to T-DNA was utilized along with a short arbitrary primer(AD1/AD2/AD3).The right-border specific primers were TR1,TR2,TR3and left-border specific primers were LB1,LB2and LB3.

2.8.Purification,cloning and in silico sequence analysis

The PCR amplified products were separated on1% agarose gel.The500bp band from left-border and360bp band from right-border were excised and eluted using the QIAquick Gel extraction kit(Qiagen).The eluted PCR amplified fragment was cloned into pDrive using QIAGEN PCR cloning kit.The positive clones were sequenced using automated sequencer(ABI Prism).The sequences were aligned with the Arabidopsis genome sequence available in the National Center for Biotechnology Information(NCBI) database by BLAST(Altschul et al.,1990).The nucleotide sequences presented in this paper have been submitted to the NCBI database.In silico restriction analysis of the identified sequence was carried out using Web Cutter available at http://rna.lundberg.gu.se/cutter2/index.html.In silico pro-moter prediction and transcription start site prediction of identified sequence were carried out by PlantDB database (Shahmuradov et al.,2003)available at http://www. https://www.sodocs.net/doc/6718373135.html,/berry.phtml.PLACE database(Higo et al., 1999)available at http://www.dna.affrc.go.jp/PLACE/and PlantCARE database(Lescot et al.,2002)available at http://oberon.fvms.ugent.be:8080/PlantCARE/index.html were used to identify cis-acting regulatory elements present in the sequence.The number of PPR repeats was determined by Pfam protein families database(Bateman et al.,2004) available at https://www.sodocs.net/doc/6718373135.html,/Pfam/.Targeting se-quence for cellular localization in the identified PPR protein was predicted by Target P analysis(Emanuelsson et al.,2000) available at http://www.cbs.dtu.dk/services/TargetP/,Predo-tar(0.5),available at http://www.inra.fr/predotar/(Small et al.,2004)and Mitoprot(1.0a4)(Claros and Vincens,1996) available at http://ihg.gsf.de/ihg/mitoprot.html.The protein hydropathy(Kyte and Doolittle,1982)for LOJ gene product was calculated and the hydropathy plot was obtained using Secondary Structure Prediction Tool for Proteins available at https://www.sodocs.net/doc/6718373135.html,/courses/ compbio/flc/home.html.

2.9.Reverse transcription polymerase chain reaction

Total RNA was isolated using RNAeasy Plant Mini Kit (Qiagen).The quality and quantity of RNA were analyzed by agarose gel electrophoresis containing4%formaldehyde

Table1

Nucleotide sequences of primers used for PCR amplification in the present study

S.no Name of the primers Sequence(5V–3V)

1GUS forward5V GCCATTTGAAGCCGATGTCACGCC3V

2GUS reverse5V GTATCGGTGTGAGCGTCGCAGAAC3V

3Bar forward5V CCACTACATCGAGACAAGCACGG3V

4Bar reverse5V CGCGTGAGATCAGATCTCGG3V

5TR15V CGGCTTTCTTGTAACGCGCTTTC3V

6TR25V CCACCAACGCTGATCAATTC3V

7TR35V GGGGTTTCTACAGGACGTAACA3V

8LB35V GACACTGGGATTCGTCTTGGAC3V

9LB25V GACAACCCTCAACTGGAAACGG3V,

10LB15V CCACGGAATAGTTTTGGCCAGACC3

11AD15V NTCGA(G/C)T(A/T)T(G/C)G(A/T)GTT3V

12AD25V NGTCGA(G/C)(A/T)GANA(A/T)GAA3V

13AD35V(A/T)GTGNAGANCANAGA3V

14JPR15V GTTCTCAGCTAGCTTCAGCTTG3V

15JPR25V CAAGACCAAGAGTCAATTTTGGG3V

16JPR35V ATGTTTTAATGCTGGTGTACGAG3V

17JPR45V AAGCCACTATAGGCTATCAATTC3V

18JPR55V ACGCGTCGACAAGAAGGGAATAG3V

19RR-15V CGTCTTACAAGCAGCTTGAAC3V

20RR-25V GAACAACCTTTCGATCCACCATC3V

21RR-35V GTCTCGACTTTGATTATCCGG3V

22RR-45V TGATTATCCGGTGGATGGAGA3V

23JRT149F5V CCCATTTCTTCACAGACTCGAT3V

245V RACE outer primer5V GCTGATGGCGATGAATGAACACTG3V

255V RACE inner primer5V CGCGGATCCGAACACTGCG TTTGCTGGCTTTGATG3V 26ACT8Forward5V ATGAAGATTAAGGTCGTGGCA3V

27ACT8Reverse5V GTGCACAAATGACAAAGGGGAA3V

28GUS500F5V CCGTTCTACTTTACTGGCTTTGG3V

A.M.Prasad et al./Gene353(2005)67–7969

and by a UV spectrophotometer.Equal amounts(500ng)of total RNA were used as the template for the RT-PCR reaction.Amplification of Actin8(ACT8)gene(An et al., 1996)was used as a positive control for RT-PCR.The JRT149F/RR-2and ACT8forward/ACT8reverse primers were used for RT-PCR amplification of LOJ and ACT8 transcripts,respectively.All the RT reactions were per-formed using RT-PCR kit(Qiagen).Primers JPR1and JPR2,which were used to amplify a664bp fragment of upstream sequence of LOJ from the genomic DNA,were also used for amplification in the RT-PCR to detect genomic DNA contamination,as negative control.

2.10.5V RACE PCR

The5V RACE was carried out to map the transcription start site using First Choice RLM-RACE Kit(Ambion).The total RNA was isolated using Plant RNAeasy Kit(Qiagen) and was tested for its quality by RT-PCR using primers for the LOJ gene.The RNA sample was prepared for the RACE as described in the kit protocol.The5V RACE outer primer/ RR-1primer set for the primary PCR reaction and5V RACE inner primer/RR-2primer set for the secondary reaction were used;RR-2is at a distance of600bp downstream of the ATG of the LOJ gene.In a second set of5V RACE reaction,RR-3and RR-4nested primers were used;RR-4is at a distance of110bp downstream of the ATG of the LOJ gene.

2.11.Constructs and generation of transgenic plants

The LOJ promoter fragments were amplified from the genomic DNA using various sets of forward and reverse primers for different product sizes.JPR1and JPR2for a 664bp fragment,JPR1and JPR3for a1.10kb fragment, JPR1and JPR4for a2.1kb fragment and JPR1and JPR 5for a2.26kb fragment.These fragment sizes represent the number of nucleotides upstream of the translation initiation site(ATG)of LOJ.The amplified p LOJ frag-ments were cloned in a pDrive vector.The inserts from these vectors were released by restricting them with Bam HI and Sal I.The released fragments were cloned into pBI101(Clontech)(a binary plant transformation vector),harbouring a uid A gene fused to the nos transcription terminator,to make p LOJ::GUS constructs. The binary vectors(p LOJ::GUS constructs)were mobi-lized into Agrobacterium strain GV3101and were introduced into wild type Arabidopsis Columbia plants by floral dip method as previously described(Clough and Bent,1998).

2.12.Accession numbers

The T-DNA flanking sequences(right border and left border)and upstream region of LOJ driving lateral organ junction specific expression have been deposited in GenBank with accession numbers CC470879,CC761656and AY581053,respectively.

3.Results

3.1.Pattern of GUS expression in line149

From a new collection of more than500T-DNA tagged Arabidopsis plants generated using the vector pCS1(Sivanandan,2004),one of the designated lines (149)exhibited GUS expression in all lateral organ junctions and was subjected to further analysis.The line 149did not display any mutant phenotype and behaved exactly like the wild type under the normal growing conditions in the greenhouse.Similarly,no difference could be detected between line149and wild type under in vitro conditions when grown on medium supplemented with various growth regulators(data not shown).The plants were examined for GUS expression throughout the life of the plants.GUS expression was observed at the junction of cotyledonary leaves in6-day-old seedling (Fig.1A).GUS expression persisted at the petiole–stem junction of all the expanded leaves(Fig.1B).Intense GUS expression was observed in the junction region of the seedlings at multiple leaf stage(Fig.1C).GUS activity was also detected at the primary and lateral root junctions(Fig.1D,E).GUS expression was seen at the junction of floral whorls and at the junction of stem and pedicel(Fig.1F,G).No GUS expression could be detected during the first24h of incubation for germination(Fig.1H).In2and3-day-old seedling,a faint GUS expression was observed at the junction of cotyledons(Fig.1I).Longitudinal(Fig.1J,K)and trans-verse(Fig.1L)sections through the shoot apex of6-day-old seedlings revealed that GUS activity was present in the shoot apical meristem and its adjacent cells.No GUS activity was detected in the anthers,stigma,internodes, leaf lamina,etc.In developing siliques,however,GUS expression was detected just at base of the siliques and no GUS expression was detected in developing embryos or seeds.The T2and T3plants of line149analyzed (150each),consistently showed identical GUS expres-sion pattern.

3.2.Number of T-DNA loci

Segregation analysis:Loci number of T-DNA inserts was determined based on the segregation in T2gen-eration for Basta resistance and Basta sensitivity.The calculated v2value fits into the3:1segregation ratio suggesting that the T-DNA inserts were inherited in a simple Mendelian fashion(3:1Basta r:Basta s ratio)in the T2generation of line149.The copy number of the T-DNA insert was further confirmed by Southern blot analysis(Section3.5).

A.M.Prasad et al./Gene353(2005)67–79 70

3.3.Isolation of T-DNA flanking sequences

Thermal Asymmetric Interlaced (TAIL)-PCR (Liu et al.,1995)was used to amplify genomic DNA flanking the T-DNA element.A 500bp amplified product from line 149DNA was obtained using AD2primers and LB specific primers and cloned in a pDrive vector to yield clone 149LB.Similarly,to clone the sequence flanking the T-DNA right border,TAIL PCR was performed using right border specific primers and a set of arbitrary primers (AD).A 360bp fragment was amplified from the right border-flanking region.This fragment was also cloned in pDrive to yield

149RB.The cloned fragments were sequenced (GenBank accession https://www.sodocs.net/doc/6718373135.html,470879and CC761656).3.4.BLAST analysis

Both the cloned fragments show complete homology with A.thaliana chromosome 2clone T16B24.13.Both the 500bp and 360bp sequence flanking left and right borders of T-DNA respectively correspond to locus At2g39230.At2g39230has been shown to contain a single ORF (2604bp),predicted to encode for a 97.65kD protein belonging to PPR family.The T-DNA

insertion

Fig.1.GUS expression pattern in Arabidopsis promoter trap line 149.(A)6-day-old seedling showing GUS expression at the junction of cotyledonary leaves.(B)1-month old plant showing GUS expression at the lateral organ junctions.(C)12-day-old seedling showing intense GUS expression in the junction of leaves.(D)12-day-old seedling showing GUS expression at the primary and lateral root junctions.(E)Magnified view (20?)of lateral root junction of a 12-day-old seedling.(F)GUS expression in a mature flower.(G)GUS expression in inflorescence of a plant.(H)No GUS expression is observed at the junction of the cotyledonary leaves of 1-day-old seedling.(I)Magnified view (20?)of junction region of cotyledonary leaves of a 3-day-old seedling.(J)Longitudinal sections through junction of cotyledonary leaves (6-day-old seedling).(K)Magnified view (40?)of region showing GUS expression in panel J.Note that GUS expression is seen in all the cells including shoot apical meristem and leaf primoridia.(L)Transverse section through junctions of cotyledonary leaves (6-day-old seedling),showing GUS expression in all the cells including shoot apical meristem and leaf primoridia,10?magnification.Arrows indicate the region of GUS expression.

A.M.Prasad et al./Gene 353(2005)67–7971

was located 247bp upstream of the predicted initiation (ATG)codon of this locus (Fig.2A).The other nearest gene (At2g39220)codes for a putative patatin and is transcribed in a direction opposite to both At2g39230and the inserted GUS.Sequence comparison revealed that there is incorporation of a stretch of additional 37nucleotides in line 149,replacing a stretch of wild type 27nucleotides at the site of right border T-DNA integration.However,the integration at the left border was perfect.

Based on the expression of the GUS reporter gene in the promoter trap line 149,the corresponding gene,At2g39230,was named LOJ (LATERAL ORGAN JUNCTION ).Analysis with Pfam protein families database (Bateman et al.,2004)suggests that LOJ gene product carries 19PPR repeats.The repeats start from 170th amino acid and extend up to 835th amino acid residue (Table 2).Analysis with Target P

(Emanuelsson et al.,2000)indicates the presence of a probable mitochondrial targeting sequence at the N-terminal region.The probability score for mitochondrial signaling for this protein for an input amino acid sequence length of 60residues is 0.542.Further analysis using Predotar (0.5)(Small et al.,2004)and Mitoprot (1.0a4)(Claros and Vincens,1996)also predicts the targeting of this protein to mitochondria with probability scores of 0.990and 0.7712,respectively.Protein hydropathy (Kyte and Doolittle,1982)analyses show that the PPR protein contains several hydrophobic domains (data not shown).3.5.Southern blot analysis

In order to confirm the presence of T-DNA and to determine the number of copies of T-DNA,Southern hybridization was performed between genomic DNA from

PATATIN

PPR

T-DNA Insertion

Fig.2.(A)Schematic diagram showing the position of the T-DNA insertion in line 149.The insertion was located between At2g39220(green colour arrow)and At2g39230(red colour arrow).The two loci have been predicted to encode for proteins belonging to patatin and PPR families,respectively,and are transcribed in opposite direction.The distance between the two genes is 4983bases.(B)Schematic diagram depicting the various primers (black arrow)designed to amplify the upstream regulatory regions of LOJ (At2g39230)gene.The four PCR amplified upstream regions were cloned at the upstream of the uid A gene in pBI101vector for plant transformation.TSS is transcription start site (+1),at a distance of 95bases upstream of the start codon (ATG)of LOJ (At2g39230)gene.(For interpretation of the references to colour in this figure legend,the reader is referred to the web version of this article.)

A.M.Prasad et al./Gene 353(2005)67–79

line149and500bp GUS probe(Fig.3A).The presence of a single band in the lanes carrying Eco RI(lane2,Fig. 3B),Hin dIII(lane3,Fig.3B)and Nde I(Lane4,Fig.3B) digests of the genomic DNA indicated insertion of T-DNA at a single locus in line149.As the Eco RI cuts 5199bp from RB within the T-DNA,a fragment of size more than5.2kb was expected.Similarly,appearance of 2.4kb band with Hin dIII digested lane(lane3,Fig.3B) was also of expected size because Hin dIII cuts2117bp from right border within the T-DNA region.The appearance of8.4kb band in the Nde I digested lane (lane4,Fig.3B)was also of expected size because Nde I does not cut within the T-DNA and a band of the size of 7.0kb or higher was expected.

3.6.Expression pattern of LOJ mRNA in wild type and line 149

The developmental expression of LOJ was analyzed by RT-PCR analysis in wild type Arabidopsis plants.LOJ transcript of550bp was detected in total RNA isolated from leaves,stem,flowers,roots and seedlings(lanes2–5, Fig.4A),whereas,LOJ transcript was not detected in the RNA isolated from leaf lamina without petiole from line 149and wild type plants(lanes2and3,Fig.4B).The transcript was present in the total RNA isolated from leaves of wild type plant(lane7,Fig.4B),but was absent in the RNA isolated from leaves of line149(lanes6,Fig.4B).The ACT8transcript of250bp,as a positive control was detected in all the RNA samples tested(lanes6and7,Fig. 4A and lanes4and5,Fig.4B).The expression pattern of GUS(a1.0kb GUS specific transcript)in line149was similar to that of LOJ observed in the wild type Arabidopsis (data not shown).3.7.Identification of transcription start site(+1site)

Two sets of RACE reactions were carried out,one with a primer set at a distance of600bp downstream of the ATG of the LOJ gene and the second at a distance of110bp downstream of the ATG of the LOJ gene(Fig.5A).With the first set,a750nucleotide and with the other set250 nucleotide long products were obtained(Fig.5B and C). Both the amplified products were cloned in pGEMT easy (Promega)vector and sequenced.The sequences from5V RACE were compared with the sequence of At2g39230 along with the upstream sequence of this gene using pair wise BLAST to locate transcription start site of this gene.The transcription start site was mapped at a G,95bp upstream from the initiation codon of At2g39230ORF.

3.8.Expression pattern conferred by LOJ upstream region

In order to confirm the GUS expression pattern in T-DNA tagged line149,we amplified different lengths of upstream regulatory regions of LOJ gene(Fig.2B)using different primers(Table1)and constructed four different LOJ promoter::GUS reporter fusion constructs.The p LOJ664::GUS contains the664bp of genomic DNA upstream of the start codon(ATG)of the LOJ gene fused to the uid A gene present in the binary vector pBI101. Similarly,the p LOJ1.10::GUS;p LOJ2.1::GUS; p LOJ2.26::GUS contain the 1.10kb, 2.1kb, 2.26kb fragments of genomic DNA upstream the ATG,respectively. These constructs were used to transform Arabidopsis ecotype Columbia.The transformation frequency of this experiment was about1%.A total of25independent transformants was obtained in case of p LOJ664::GUS construct,16for p LOJ1.10::GUS,21for p LOJ2.1::GUS and13for p LOJ2.26::GUS construct.The seeds obtained from different transformed plants were considered as independent insertion.

All transformants were examined for GUS expression. In majority of the transformants,GUS expression was detected in all lateral organ junctions(Fig.6A–I)and they appeared to follow the same specific pattern of expression as that of line149.GUS expression was observed at the petiole and stem junction of the expanded leaves(Fig.6A).GUS expression was also detected at lateral organ junctions in the inflorescence(Fig.6B–D). Intense GUS activity was observed in the junction of multiple leaves of15-day-old seedling(Fig.6E).After germination,no GUS activity could be detected up to36 h(Fig.6F).GUS expression was observed at the junction of cotyledons in2,3and5-day-old seedlings(Fig.6G–I). GUS expression pattern was found to be identical in all the lines analyzed,except for a few,which deviated from the specific expression pattern.Only one line obtained for p LOJ664::GUS showed expression in anthers and seeds other than the lateral organ junctions.The GUS expres-sion was also deviant in two of the p LOJ1.1::GUS and

Table2

Location of PPR repeats in the protein(867amino acids)encoded by LOJ

(At2g39230)gene predicted by Pfam protein families database(Bateman et

al.,2004)available at https://www.sodocs.net/doc/6718373135.html,/Pfam/

PPR domain Start End

1170204

2205239

3240274

4275309

5311345

6346380

7381415

8450484

9485519

10520554

11555589

12591625

13626660

14661695

15696730

16731765

17766800

18801835

19416440

A.M.Prasad et al./Gene353(2005)67–7973

three of the p LOJ 2.26::GUS construct line (data not shown).The remaining transformants typically exhibited an identical GUS expression pattern as obtained with the T-DNA tagged line 149,without any deviation.

3.9.In silico promoter prediction and characterization of regulatory sequence of LOJ

In silico promoter analysis using PlantDB database did not predict any promoter element/TSS for ¨1kb upstream region of LOJ .Using PLACE database and Plant CARE,the upstream region of 569bp (à1to à569)of LOJ was carried out to find out the probable signal sequences.Various signal sequences were identified in the 569bp promoter region (GenBank accession nos.AY581053).However,the results indicate that LOJ gene does not have any TATA or CAAT boxes,within the first 146base upstream region.

4.Discussion

Using promoter trap vector,we have identified a gene LOJ and have thus provided the experimental proof for the hypothetical gene At2g39230.Since,T-DNA mutagenesis of this gene does not confer any visible phenotypic change;the gene could not have been easily identified by other approaches,highlighting the importance of promoter trap method for gene/promoter discovery in plants.

4.1.LOJ is expressed in lateral organ junctions and shoot apical meristem

The LOJ gene was identified based on the GUS expression pattern of the promoter trap line 149.Although the insertion of T-DNA was à152bp upstream,still no LOJ transcript was detected in the RNA isolated from various plant parts of homozygous line 149indicating that the gene

9.5 kb

8.4 kb Plant genome

T-DNA

2Eco RI

Hind III

Nde I 34

probe

6.7 kb

2.4 kb

Fig.3.Southern blot analysis of line 149.(A)Schematic diagram of the T-DNA showing position of probe and the sites of various restriction enzymes used in Southern hybridisation.(B)Southern hybridisation of line 149DNA with 500bp GUS probe showing presence of single insert.Total genomic DNA was isolated and digested (5A g)with the appropriate restriction enzymes subjected to 0.8%agarose gel electrophoresis and transferred to a nylon Hybond+membrane as described in Material and methods.The blot was than hybridized with the 500bp GUS specific 32P labeled https://www.sodocs.net/doc/6718373135.html,ne 1:positive control pCS1plasmid digested with Nde I (9.5kb band),lane 2:149DNA digested with Eco RI (6.7kb band),lane 3:149DNA digested with Hin dIII (2.4kb band),lane 4:149DNA digested Nde I (8.4kb band),lane 5:wild type DNA digested with Eco RI.Nde I does not cut within the T-DNA.

A.M.Prasad et al./Gene 353(2005)67–79

was knocked out because of T-DNA integration.On the other hand,in the wild type plant,expression of LOJ transcript was detected in young plants and the expression persisted till maturity,however,RT-PCR of RNA isolated from leaf lamina without petiole did not detect the LOJ transcript suggesting that expression of LOJ is restricted to the junctions.This fact also suggests that the expression of LOJ gene is tightly regulated and expressed throughout plant development only in the junction regions.As LOJ is expressed at the junction of the lateral organs in the shoot and root,one possible function of genes expressed in such a pattern is to define a boundary between the initiating organ primordia and the stem cells they are derived from.As lateral organs initiate in the shoot and the root,founder cells from the SAM and pericycle,respectively,are recruited into forming lateral organs (Steeves and Sussex,1989;Laskow-ski et al.,1995).

A number of plant genes that are expressed in the vegetative shoot apex in a pattern similar to LOJ have been described including UNUSUAL FLORAL ORGAN (UFO ),

No Apical Meristem (NAM )and the cup shaped cotyledon CUC1,CUC2,CUC3,LATERAL ORGAN BOUNDARIES (LOB )gene and CUPULIFORMIS (Souer et al.,1996;Aida et al.,1997;Lee et al.,1997;Takada et al.,2001;Shuai et al.,2002;Vroemen et al.,2003;Weir et al.,2004).Analysis of the loss of function for these genes by earlier workers supports the idea that some of these genes are important for the establishment of a boundary between organs.Mutations in No Apical Meristem (NAM )cause a loss of the SAM and fusion of cotyledons,cuc1and cuc2double mutants have fused cotyledons and do not form a SAM.ufo mutants have aberrant floral organs but no vegetative phenotype,suggest-ing that UFO acts redundantly in the vegetative shoot apex.Fused cotyledons are also found in the cuc3mutant and in double or triple mutant of cuc3and cuc1,and/or cuc2(Vroemen et al.,2003)and in cup mutant of Antirrhinum (Weir et al.,2004).In addition to cotyledon fusion,several lateral organs are also fused in leaves and inflorescence in cup mutants with fasciated apical meristem (Weir et al.,2004).

Based on the GUS activity in the prompter trap line 149,LOJ expression appears to commence later than that of UFO ,CUC1,CUC2/CUC3.Although it is possible that the LOJ is expressed earlier,but at levels that are not detectable using the GUS reporter,these observations may indicate that LOJ functions in the later stage of lateral organ develop-ment.Interestingly,LOJ expression pattern overlaps with the earlier identified gene LATERAL ORGAN BOUNDA-RIES (LOB )gene,which is expressed in the boundaries of lateral organs formed from SAM and also in a ring of cells at the base of lateral roots (Shuai et al.,2002).However,a major difference between the expression of LOJ and LOB is that LOB does not express in shoot apical meristem.Moreover,LOB gene expression commences at the torpedo stage embryo while the expression of LOJ can be seen only after germination.Similarly,CUC3is expressed in a wide variety of boundaries in the seedling and adult plant generally separating two proliferating organs or cells from its surrounding cells.None of the Arabidopsis CUC1(Takada et al.,2001),CUC2(Ishida et al.,2000)and petunia NAM (Souer et al.,1996)genes show expression at the base of lateral roots.Expression pattern of HAESA,involved in proper abscission of floral organs,is similar to that observed for LOJ in floral organs.(Jinn et al.,2000).However,HAESA expression appears to initiate later than that of LOJ .In line 149,GUS expression also persisted at the base of siliques,which is actually the junction (a compressed joint)from where petals,sepals and stamens emerge.The GUS expression persistence at this point indicates the expression of LOJ at the junctions region;however,its function may not be related to abscission,since at the base of siliques lateral organs (e.g.petals,sepals)have abscised.Unlike other genes that show similar expression pattern as LOJ ,disruption of LOJ caused no morphological abnormality.This suggested that its function is redundant or it has role only under special conditions.

550bp 250bp

750 bp 500 bp 250 bp

1 2 3 4 5 6 7

550bp 250bp

750 bp 500 bp 250 bp

1.0 kb 1 2 3 4 5 6 7

Fig.4.RT-PCR analysis of LOJ transcripts in wild type Arabidopsis and line 149.(A)RT-PCR of LOJ gene transcripts in wild type leaf,stem,flowers and root RNA.A band of 550bp of LOJ transcript was amplified in all the plant parts https://www.sodocs.net/doc/6718373135.html,ne 1:1kb ladder,lane 2:leaf,lane 3:stem,lane 4:flowers,lane 5:root,lane 6:RT-PCR of Actin8gene transcripts in wild type leaf RNA,lane 7:RT-PCR of Actin8gene transcripts in wild type flower RNA.A band of 250bp of ACT8transcripts in wild leaf and flower RNA was amplified as positive control.(B)RT-PCR analysis of LOJ transcripts in wild type Arabidopsis and line https://www.sodocs.net/doc/6718373135.html,ne 1:1kb ladder,lane 2:RT of LOJ transcript in RNA from leaf without petiole of line149,lane 3:RT of LOJ transcript in RNA from leaf without petiole of wild type,lane 4:RT of Actin8transcript in RNA from leaf without petiole of line149,lane 5:RT of Actin8transcript in RNA from leaf without petiole of wild type,lane 6:RT of LOJ transcript in RNA from leaf of line149,lane 7:RT of LOJ transcript in RNA from leaf of wild type;No amplicon was observed in either line 149RNA (lane2)or wild type RNA (lane3)isolated form leaf without petiole.An amplicon of 550bp amplified from LOJ transcript was observed in RNA from wild type leaf (with petiole)(lane 7),whereas in case of line 149the transcript was not detected (lane 6).

A.M.Prasad et al./Gene 353(2005)67–7975

4.2.LOJ gene is a member of a gene family with a conserved PPR domain

The LOJ gene belongs to a class of genes,which encode for proteins containing a highly conserved pentatricopeptide repeats,designated as PPR domain.PPR genes are found in plant,animal or yeast sequence in the databases.The PPR protein family is characterized by tandem repeats of a degenerate motif of 35amino acid (Small and Peeters,2000),often arranged as tandem array of 2–26repeats per peptide.Members of this family appear frequently in higher plants and more than 450members have been identified in Arabidopsis.

In plants also,PPR proteins have been shown to regulate organeller gene expression through interaction with RNA.In fact,majority of plant PPR genes characterized to date are either involved in male fertility restoration through mod-ification of mitochondrial transcripts,such as Rf of petunia (Bentolila et al.,2002)Rfk1(Rfo )of radish (Brown et al.,2003;Desloire et al.,2003;Koizuka et al.,2003),rice Rf-1(Kazama and Toriyama,2003;Komori et al.,2004;Akagi et al.,2004)or are associated with plastid gene expression,such as maize CRP1(Barkan et al.,1994;Fisk et al.,1999),radish P67(Lahmy et al.,2000),HCF152(Meierhoff et al.,2003),PGR3(Yamazaki et al.,2004)and Arabidopsis PPR gene CRR4(Kotera et al.,2005).Some PPR genes like EMB175have been shown to play an essential role in plant embryogenesis (Cushing et al.,2005).

Many PPR proteins are targeted to either mitochondria or chloroplasts (Lurin et al.,2004;Small and Peeters,2000).The LOJ protein,which carries 19PPR repeats also,possesses a mitochondrial signal peptide sequence.The signal peptide was identified by Target P software (Ema-nuelsson et al.,2000).

However,the GUS expression pattern indicates potential role of this particular gene in the development of shoot apical meristem and the lateral organs.Therefore,there is possibility that PPR motif containing proteins may play

600 bp

110 bp

L 1 2

750 bp

1.0 kb 750 bp 500 bp 250 bp

L 1 2

1.0 kb 750 bp 500 bp 250 bp

Fig.5.Mapping of the transcription initiation site of LOJ (At2g39230)gene.(A)Schematic diagram of LOJ (At2g39230)gene in Arabidopsis genome depicting the presence of two sets of primers used for 5V RACE reaction.(B)5V RACE of LOJ transcript using wild type flowers RNA,with 5V RACE specific primer and LOJ gene specific primer.Agarose gel electrophoresis of 5V RACE PCR products.A band of 750bp was amplified in the secondary 5V RACE https://www.sodocs.net/doc/6718373135.html,ne 1:primary 5V RACE PCR reaction using 5V RACE outer primer and RR-1primer,lane 2:secondary 5V RACE PCR reaction using 5V RACE inner primer and RR-2primer,L is 1kb ladder.(C)Another set of 5V RACE reaction using wild type flowers RNA.A band of 250bp was amplified in the secondary 5V RACE https://www.sodocs.net/doc/6718373135.html,ne 1:secondary 5V RACE PCR reaction using 5V RACE inner primer and RR-4primer,lane 2:secondary 5V RACE PCR reaction using 5V RACE inner primer and RR-4primer (primary reaction product is diluted 20times and used as template for secondary reaction),L is 1kb ladder.RACE was performed using 5V RACE RLM kit (Ambion)and taking 10A g of total RNA as a starting material for the reaction.The sequences of all the primers used in 5V RACE reaction are listed in Table 1.Both the amplified products were cloned in pGEM-T Easy vector and were sequenced.

A.M.Prasad et al./Gene 353(2005)67–79

other important roles in the lateral organ development of plant besides fertility restoration.None of the genes identified so far, e.g.LOB,CUC1,CUC2,CUC3and CUPULIFORMIS,associated with lateral organ and SAM development belong to the PPR gene family.While CUC1, CUC2,CUC3and CUPULIFORMIS(Aida et al.,1997; Takada et al.,2001;Vroemen et al.,2003;Weir et al.,2004) encode a putative NAC-domain transcription factor,LOB protein contains a lob domain(Shuai et al.,2002).However, the gene identified by us does not show any homology to above mentioned genes,thus our work has led to the identification of a novel gene having potential role in lateral organ development and SAM as indicated by the GUS expression pattern.Moreover,majority of PPR proteins have been shown to express constitutively or in a circadian rhythm(Lurin et al.,2004;Oguchi et al.,2004).To the best of our knowledge,expression pattern of LOJ is novel for any PPR protein reported.

4.3.LOJ promoter is not a typical plant promoter

The upstream region at site of T-DNA integration was searched for cis-acting regulatory elements using PLACE database and Plant CARE.In silico promoter prediction analysis by PlantDB database did not predict any promoter element.In silico analysis of the upstream region by PLACE database and Plant CARE failed to identify a TATA box withinà146nucleotides.This suggested that LOJ expres-sion is driven by a TATAless promoter in the plant system, which is different from earlier identified monocot or dicot plant promoters,driving expression of LOJ in a very specific pattern.The upstream sequence constructs(p LOJ::-GUS)have mimicked the expression pattern of line149. The GUS expression was found to be similar in all the (p LOJ::GUS)transformant lines except for a few deviants. The deviations in expression pattern could be due to position effect and other transformation related reasons. Another possibility is that these insertions were adjacent to strong promoter or enhancer sequence that affected activity of the LOJ promoter in the p LOJ::GUS constructs.To date, we have not been able to associate a loss-of-function phenotype with LOJ.Although,LOJ gene product exhibited homology with several other proteins mainly because of the presence of PPR repeats.However,only one hypothetical gene(At3g54980)showed extensive homology to LOJ with 59%identity.Analysis with Target P,Predotar(0.5)and Mitoprot(1.0a4)also suggests mitochondrial localization of the gene product of https://www.sodocs.net/doc/6718373135.html,ck of any mutant

Fig.6.GUS expression pattern in Arabidopsis p LOJ664::GUS transformants.(A)Mature plant showing GUS expression at leaf petiole and stem junction.(B) GUS expression at base of the siliques in mature plant.(C)Inflorescence.(D)Flowers.(E)GUS expression during seedling development,15-day-old seedling showing GUS expression in the junctions of the cotyledonary leaves.(F)24-h-old seedling(no GUS expression detected).(G)2-day,(H)3-day,(I)5-day-old seedlings.Arrows indicate the region of GUS expression.

A.M.Prasad et al./Gene353(2005)67–7977

phenotype in line149could be because of the strong homology between the two.Further characterization of the LOJ and the related gene will be needed to elucidate the role of LOJ in plant development.

The present study underscores the importance of complementary approaches for gene and promoter discov-ery.While in silico analysis of genome sequence was found to correctly predict the LOJ gene(At2g39230),the experimental proof of its expression could be established thorough promoter trap method.On the other hand,the shortcomings of in silico approaches were evident from the failure of the software to identify promoter region upstream to LOJ coding sequence.A lack of mutant phenotype in LOJ gene knock out(homozygous line149)demonstrates the need for other approaches such as over-expression studies for assigning function to LOJ protein.Further characterization of LOJ and related gene is needed to establish the role of LOJ in plant development. Acknowledgements

We thank Dr.David Bouchez(INRA Centre de Versailles,Versailles Cedex,France)for providing pEC-2 vector for constructing pCS1in our lab.We acknowledge Dr.K.V.Prabhu(National Phytotron Facility,IARI,India) for his help in growing Arabidopsis in growth chambers and Greenhouse.We thank Dr.B.Sreekanth for his expert help in sectioning and microscopy.We acknowledge Dr.Ian Small(INRA/CNRS/UEVE,Cedex,France)for help with the bioinformatic analysis of LOJ gene.This research was funded in part by NATP,CGP grant(CGPII/253).Financial support to AMP,CS,RNR by CSIR and UGC,is gratefully acknowledged.We are grateful to Dr.Vani Shankar for editing the manuscript.

References

Aida,M.,Ishida,T.,Fukaki,H.,Fujisawa,H.,Tasaka,M.,1997.Genes involved in organ separation in Arabidopsis:an analysis of the cup-shaped cotyledon mutant.Plant Cell9,841–857.

Akagi,H.,et al.,2004.Positional cloning of the rice Rf-1gene,a restorer of BT-type cytoplasmic male sterility that encodes a mitochondria-targeting PPR protein.Theor.Appl.Genet.108,1449–1457. Altschul,S.F.,Gish,W.,Miller,W.,Myera,E.W.,Lipman,D.J.,1990.

Basic local alignment search tool.J.Mol.Biol.215,403–410.

An,Y.-Q.,McDowell,J.M.,Huang,S.,Mckineey,E.C.,Chambliss,S., Meagher,R.B.,1996.Strong,constitutive expression of the Arabidopsis ACT2/ACT8actin subclass in vegetative tissues.Plant J.10,107–121. Barkan, A.,Walker,M.,Nolasco,M.,Johnson, D.,1994.A nuclear mutation in maize blocks the processing and translation of several chloroplast mRNAs and provides evidence for the differential trans-lation of alterative mRNA forms.EMBO J.13,3170–3181. Bateman,A.,et al.,2004.The Pfam protein families database.Nucl.Acids Res.Database Issue32,D138–D141.

Bentolila,S.,Alfonso,A.A.,Hanson,M.R.,2002.A pentatricopeptide repeat-containing gene restores fertility to cytoplasmic male-sterile plants.Proc.Natl.Acad.Sci.U.S.A.99,10887–10892.Brown,G.G.,et al.,2003.The radish Rfo restorer gene of Ogura cytoplasmic male sterility encodes a protein with multiple pentatrico-peptide repeats.Plant J.35,262–272.

Claros,M.G.,Vincens,P.,https://www.sodocs.net/doc/6718373135.html,putational method to predict mitochondrially imported proteins and their targeting sequences.Eur.

J.Biochem.241,779–786.

Clough,S.J.,Bent, A.F.,1998.Floral dip:a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J.16,735–743.

Cushing,D.A.,Forsthoefel,N.R.,Gestaut,D.R.,Vernon,D.M.,2005.

Arabidopsis emb175and other ppr knockout mutants reveal essential roles for pentatricopeptide repeat(PPR)proteins in plant embryo-genesis.Planta(Jan13,Epub ahead of print).

Desloire,S.,et al.,2003.Identification of the fertility restoration locus,Rfo, in radish,as a member of the pentatricopeptide-repeat protein family.

EMBO Rep.4,588–594.

Emanuelsson,O.,Nielsen,H.,Brunak,S.,V onHeijne,G.,2000.Predicting subcellular localization of proteins based on their N-terminal amino acid sequence.J.Mol.Biol.300,1005–1016.

Feldmann,K.A.,Marks,M.D.,1987.Agrobacterium-mediated transforma-tion of germinating seeds of Arabidopsis thaliana.Mol.Gen.Genet.

208,1–9.

Fisk,D.G.,Walker,M.B.,Barkan,A.,1999.Molecular cloning of the maize gene crp1reveals similarity between regulators of mitochondrial and chloroplast gene expression.EMBO J.18,2621–2630.

Higo,K.,Ugawa,Y.,Iwamoto,M.,Korenaga,T.,1999.Plant cis-acting regulatory DNA elements(PLACE)database:1999.Nucl.Acids Res.

27,297–300.

Ishida,T.,Aida,M.,Takada,S.,Tasaka,M.,2000.Involvement of CUP-SHAPED COTYLEDON genes in gynoecium and ovule development in Arabidopsis thaliana.Plant Cell Physiol.41,60–67.

Jefferson,R.A.,Karanagh,T.A.,Bevan,M.W.,1987.GUS fusion:h-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO J.6,3901–3907.

Jinn,T.,Stone,J.,Walker,J.,2000.HAESA,an Arabidopsis leucine rich repeat receptor kinase,controls floral organ abscission.Genes Dev.14, 108–117.

Kazama,T.,Toriyama,K.,2003.A pentatricopeptide repeat-containing gene that promotes the processing of aberrant atp6RNA of cytoplasmic male-sterile rice.FEBS Lett.544,99–102.

Koizuka,N.,et al.,2003.Genetic characterization of a pentatricopeptide repeat protein gene,orf687,that restores fertility in the cytoplasmic male-sterile Kosena radish.Plant J.34,407–415.

Komori,T.,et al.,2004.Map-based cloning of a fertility restorer gene,Rf-1, in rice(Oryza sativa L.).Plant J.37,315–325.

Koncz, C.,Schell,J.,1986.The promoter of the T L DNA gene5 controls the tissue specific expression of chimeric genes carried by a noval type Agrobacterium binary vector.Mol.Gen.Genet.204, 383–396.

Kotera,E.,Tasaka,M.,Shikanai,T.,2005.A pentatricopeptide repeat protein is essential for RNA editing in chloroplasts.Nature433,326–330. Kyte,J.,Doolittle,R.F.,1982.A simple method for displaying the hydropathic character of a protein.J.Mol.Biol.157,105–132. Lahmy,S.,Barneche,F.,Derancourt,J.,Filipowicz,W.,Delseny,M., Echeverria,M.,2000.A chloroplastic RNA-binding protein is a new member of the PPR family.FEBS Lett.480,255–260. Laskowski,M.J.,Williams,M.E.,Nusbaum,H.C.,Sussex,I.M.,1995.

Formation of lateral root meristems is a two-stage process.Develop-ment121,3303–3310.

Lee,I.,Wolfe,D.S.,Nilsson,O.,Weigel,D.,1997.A LEAFY co-regulator encoded by UNUSUAL FLORAL ORGANS.Curr.Biol.7,95–104. Lescot,M.,et al.,2002.PlantCARE,a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences.Nucl.Acids Res.30(1),325–327.

Liu,Y.,Mitsukawa,N.,Oosumi,T.,Whittier,R.,1995.Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR.Plant J.8,457–463.

A.M.Prasad et al./Gene353(2005)67–79 78

Lurin,C.,et al.,2004.Genome-wide analysis of Arabidopsis pentatrico-peptide repeat(PPR)proteins reveals their essential role in organelle biogenesis.Plant Cell16,2089–2103.

Meierhoff,K.,Felder,S.,Nakamura,T.,Bechtold,N.,Schuster,G.,2003.

HCF152,an Arabidopsis RNA binding pentatricopeptide repeat protein involved in the processing of chloroplast psbB–psbT–psbH–petBpetD RNAs.Plant Cell15,1480–1495.

Murashige,T.,Skoog,F.,1962.A revised medium for rapid growth and bioassays with tobacco tissue cultures.Physiol.Plant.15,473–496. Oguchi,T.,Sage-Ono,K.,Kamada,H.,Ono,M.,2004.Genomic structure of a novel Arabidopsis clock-controlled gene,AtC401,which encodes a pentatricopeptide repeat protein.Gene330,29–37.

Ostergaard,L.,Yanofsky,M.F.,2004.Establishing gene function by mutagenesis in Arabidopsis thaliana.Plant J.39,682–696. Sambrook,J.,Fritsch,E.F.,Maniatis,T.,1989.Molecular Cloning—A Laboratory Manual,2nd edition Cold Spring Harbor Laboratory Press, New York.

Shahmuradov,I.A.,Gammerman, A.J.,Hancock,J.M.,Bramley,P.M., Solovyev,V.V.,2003.PlantProm:a database of plant promoter sequences.Nucl.Acids Res.31,114–117.

Shuai, B.,Reynaga-Pen?a, C.G.,Springer,P.S.,2002.The LATERAL ORGAN BOUNDARIES gene defines a novel,plant-specific gene family.Plant Physiol.129,747–761.

Sivanandan,C.,2004.Tagging,isolation and characterization of a root-specific promoter from Arabidopsis.PhD thesis.IARI,New Delhi, India.

Small,I.D.,Peeters,N.,2000.The PPR motif—a TPR-related motif prevalent in plant organellar proteins.Trends Biochem.Sci.25,46–47. Small,I.,Peeters,N.,Legeai,F.,Lurin,C.,2004.Predotar:a tool for rapidly screening proteomes for N-terminal targeting sequences.Proteomics4, 1581–1590.Souer,E.,van Houwelingen,A.,Kloos,D.,Mol,J.,Koes,R.,1996.The No Apical Meristem gene of petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries.Cell85,159–170.

Southern, E.M.,1975.Detection of specific sequences among DNA fragments separated by gel electrophoresis.J.Mol.Biol.98,503–517. Springer,P.S.,Holding,D.R.,Groover,A.,Yordan,C.,Martienssen,R.A., 2000.The essential Mcm7protein PROLIFERA is localized to the nucleus of dividing cells during the G1phase and is required maternally for early Arabidopsis development.Development127,1815–1822. Steeves,T.A.,Sussex,I.M.,1989.Patterns in Plant Development.Cam-bridge University Press,Cambridge,UK.

Takada,S.,Hibara,K.-I.,Ishida,T.,Tasaka,M.,2001.The CUP-SHAPED COTYLEDON1gene of Arabidopsis regulates shoot apical meristem formation.Development128,1127–1135.

Vroemen,C.W.,Mordhorst,A.P.,Albrecht,C.,Kwaaitaal,M.A.,de Vries, S.C.,2003.The CUP-SHAPED COTYLEDON3gene is required for boundary and shoot meristem formation in Arabidopsis.Plant Cell15, 1563–1577.

Wei,W.,Twell,D.,Lindsey,K.,1997.A novel nucleic acid helicase gene identified by promoter trapping in Arabidopsis.Plant J.11, 1307–1314.

Weir,I.,Lu,J.,Cook,H.,Causier,B.,Schwarz-Sommer,Z.,Davies,B., 2004.CUPULIFORMIS establishes lateral organ boundaries in anti-rrhinum.Development131(4),915–922.

Yamazaki,H.,Tasaka,M.,Shikanai,T.,2004.PPR motifs of the nucleus-encoded factor,PGR3,function in the selective and distinct steps of chloroplast gene expression in Arabidopsis.Plant J.38, 152–163.

A.M.Prasad et al./Gene353(2005)67–7979

Cloning and characterization of a pentatricopeptide protein encoding gene

相关文档

最新文档