pIRES-EGFP

pIRES-EGFP Vector Information PT3157-5 GenBank Accession #: Submission in progress.Catalog #6064-1

(PR7Y616)

Bgl II

(13)

pIRES-EGFP

5.2 kb

poly A

MCS

(909–974)

Amp r

IRES

P

CMV IE

EGFP

Col E1

ori

IVS

Bgl II(1185)

Sma I(1885)

Nru I

(209)

Xho I

(2909)

Bam H I(1887)

Not I

950

?

900

?CGAGCTCGGATCGATATCTGCGGCCGCGTCGACGGAATTCAGTGGATCCA

CTAGTAACGGCCGCCAGTGTGCTGGAATTAATTCG

Cla I*

Bst X I

Bam H I

Eco R I

Eco R V

Restriction Map and Multiple Cloning Site (MCS) of pIRES-EGFP Vector. Unique restriction sites are in bold. The Cla I site (*) in the MCS is methylated in the DNA provided by CLONTECH. If you wish to digest the vector with this enzyme, you will need to transform the vector into a dam– host and make fresh DNA. The Xho I site can be used to linearize the vector before transfection when generating stable cell lines.

Description:

pIRES-EGFP contains the internal ribosome entry site (IRES) of the encephalomyocarditis virus (ECMV) between the MCS and the EGFP (enhanced green fluorescent protein) coding region. This permits both the gene of interest (cloned into the MCS) and the EGFP gene to be translated from a single bicistronic mRNA. pIRES-EGFP is designed for the efficient selection (by flow cytometry or other methods) of transiently transfected mammalian cells expressing EGFP and another protein of interest. To optimize the selection of cells expressing high levels of the protein of interest, pIRES-EGFP utilizes a partially disabled IRES sequence (1). This attenuated IRES leads to a reduced rate of translation initiation at the EGFP start codon relative to that of the cloned gene. This enables you to select those cells in which the mRNA, and hence the target protein, is produced at high levels to compensate for a suboptimal rate of translation of EGFP. This vector can also be used to express EGFP alone or to obtain stably transfected cell lines without time-consuming drug and clonal selection.

EGFP is a red-shifted variant of wild-type GFP that has been optimized for brighter fluorescence and higher expression in mammalian cells. (Excitation maximum = 488 nm; emission maximum = 509 nm.) EGFP encodes the GFPmut1 variant (2), which contains the amino acid substitutions Phe-64 to Leu and Ser-65 to Thr. These mutations increase the brightness and solubility of GFP, primarily due toimproved protein folding properties and efficiency of chromophore formation (2, 3). EGFP also contains an open reading frame comprised almost entirely of preferred human codons (4). This leads to more efficient translation and, hence, higher expression levels in eukaryotic cells, relative to wt GFP.

pIRES-EGFP was derived from pIRES1neo (#6060-1; originally described as pCIN4 by Rees et al.; 1) by replacing the neo gene downstream of the IRES sequence with the EGFP coding region. The IRES sequence permits the translation of two open reading frames from one messenger RNA (5, 6). The expression cassette of pIRES-EGFP contains the human cytomegalovirus (CMV) major immediate early promoter/enhancer followed by a multiple cloning site (MCS), a synthetic intron (IVS) known to enhance the stability of the mRNA (7), the EMCV IRES followed by the EGFP coding region, and the polyadenylation signal of the bovine growth hormone. Ribosomes can enter the bicistronic mRNA at the 5' end to translate the gene of interest and at the ECMV IRES to translate the EGFP gene.Location of features:

?P CMV IE promoter: 232–820

?Multiple cloning site (MCS): 909–974

?Synthetic intron (IVS): 974–1269

?Internal ribosome entry site (IRES) of the encephalomyocarditis virus (ECMV): 1299–1884

?Enhanced green fluorescent protein (EGFP) gene: 1905–2621

?Fragment containing the bovine growth hormone poly-A signal: 2636–2913

?Col E1 origin of replication: 3343–4016

?Ampicillin resistance gene: 5026–4168

Propagation in E. coli

?Suitable host strains: DH5α and other general purpose strains.

Note: If you wish to digest the vector with Cla I, you will need to transform a dam – E. coli host and obtain a fresh plasmid preparation.?Selectable marker: plasmid confers resistance to ampicillin (50 μg/ml) on E. coli hosts.

Transfection of mammalian cells

?To promote unrearranged integration in the host genome, we recommend linearizing the vector before transfection. However, prelinearization of the vector is not required to generate stable cell lines.

?Note that prolonged exposure to high levels of EGFP may be slightly toxic to some types of mammalian cells.References:

1.

Rees, S., et al. (1996) Biotechniques 20:102–110.2.

Cormack, B., et al. (1996) Gene 173:33–38.3.

Yang, T. T., et al . (1996) Nucleic Acids Res . 24:4592–4593.4.

Haas, J., et al. (1996) Curr. Biol. 6:315–324.5.

Jackson, R. J., et al. (1990) Trends Biochem. 15:477–483.6.

Jang, S. K., et al. (1988) J. Virol. 62:2636–2643.7.Huang, M. T. F. & Gorman, C. M. (1990) Nucleic Acids Res. 18(4):937–947.

Protocol # PT3157-5TEL :650-424-8222 or 800-662-2566 (CLON)? 1997, CLONTECH Laboratories, Inc.Version # PR7Y616FAX :650-424-1064 or 800-424-1350page 2pIRES-EGFP Vector Information Note : The attached sequence file has been compiled from information in the sequence databases, published literature, and other sources, together with partial sequences obtained by CLONTECH. This vector has not been completely sequenced.