Arginine reverses GH resistance through the inhibition of TLR4-mediated inflammatory pathway

Arginine reverses growth hormone resistance through the inhibition of

toll-like receptor 4-mediated inflammatory pathway

Jingren Xu a , Canjun Zhu a , Mengyuan Zhang a , Qingchun Tong c , Xiaojuan Wan a ,

Zhengrui Liao a , Xingcai Cai a , Yaqiong Xu a , Yexian Yuan a , Lina Wang a , Xiaotong Zhu a ,Songbo Wang a , Ping Gao a , Qianyun Xi a , b , Yong Xu d , Qingyan Jiang a , b ,?, Gang Shu a , b ,?

a

Guangdong Province Key Laboratory of Animal Nutritional Regulation, 483 Wushan Road, Tianhe District, Guangzhou, Guangdong 510642, China b National Engineering Research Center for Breeding S wine Industry, College of Animal S cience, S outh China Agricultural University, 483 Wushan Road, Tianhe District, Guangzhou, Guangdong 510642, China

c Brown Foundation Institute of Molecular Medicine, The University of Texas Health S cience Center at Houston, 7000 Fannin, S uite 1800, Houston, TX 77030, USA

d

Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA

A R T I C L E I N F O A

B S T R A

C T

Article history:

Received 24June 2017Accepted 4October 2017Objective.Growth hormone stimulates growth by increasing insulin-like growth factor 1expression and secretion.In the presence of insufficient nutrients,GH increases,whereas IGF-1expression becomes severely suppressed,leading to GH resistance.This study aimed to explore the effect of arginine (Arg)on GH resistance during malnutrition and to describe its underlying mechanism.

Methods.C57BL/6J mice were injected intraperitoneally with Arg for 1h or subjected to caloric restriction with Arg supplement in drinking water for 18days.HepG2cells were exposed to different Arg concentrations for 24h.Signaling pathway agonists/inhibitors,siRNA,and overexpression plasmids were used to investigate the underlying molecular mechanism.Liver-specific toll-like receptor (TLR4)knockout mice were utilized to clarify the role of TLR4in Arg-induced IGF-I expression and secretion.

Results.Arg inhibited the TLR4downstream pathway by binding to TLR4and consequently activated Janus kinase 2/signal transducer and activator of transcription 5signaling pathway.As a result,IGF-1transcription and secretion increased.Arg activity was absent in liver-specific TLR4knockout mice and was greatly suppressed in liver with overexpressed TLR4,suggesting that hepatic TLR4was required and sufficient to induce GH resistance.By contrast,the mammalian target of rapamycin pathway was unnecessary for Arg activity.Arg not only significantly increased IGF-1expression and secretion under acute fasting and chronic CR conditions but also attenuated body weight loss.

Keywords:Arginine IGF-1Liver Malnutrition TLR4

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–2

3

Abbreviations: Ala, alanine; Arg, arginine; CR, caloric restriction; GH, growth hormone; GHR, growth hormone receptor; GHRH, growth hormone-releasing hormone; IGF-1, insulin-like growth factor 1; IL, interleukin; IKK α/β, inhibitor of nuclear factor kappa-B kinase α/β; JAK2, Janus kinase 2; LPS, lipopolysaccharide; mTOR, mammalian target of rapamycin; PTP1B, protein tyrosine phosphatase 1B; SOCS3, suppressor of cytokine signaling 3; STAT5, signal transducers and activators of transcription 5; SST, somatostatin; TNF α, tumor necrosis factor α; TLR, toll-like receptor.

? Corresponding authors: Guangdong Province Key Laboratory of Animal Nutritional Regulation, National Engineering Research Center for Breeding Swine Industry, College of Animal Science, South China Agricultural University, 483 Wushan Road, Tianhe District, Guangzhou, Guangdong 510642, China.

E-mail addresses: qyjiang@https://www.sodocs.net/doc/f71736318.html, (Q. Jiang), shugang@https://www.sodocs.net/doc/f71736318.html, (G. Shu).https://https://www.sodocs.net/doc/f71736318.html,/10.1016/j.metabol.2017.10.006

0026-0495/? 2017 Elsevier Inc. All rights

reserved.

A v a i l a b l e o n l i n e a t w w w.s c i e n c e d i r e c t.c o m

Metabolism

w w w.m e t a b o l i s m j o u r n a l.c o m

Impact factor: 5.777

Conclusions.Our results demonstrate a previously unappreciated pathway involving Arg that reverses GH resistance and alleviates malnutrition-induced growth restriction through the inhibition of TLR4-mediated inflammatory pathway.

?2017Elsevier Inc.All rights reserved.

1.Introduction

Malnutrition,marked by lack of variant nutrients,is a leading cause of mal-development and growth deficits worldwide, especially in economically poor regions[1].Body growth is synergistically controlled by nutritional status and endocrine signaling.Under normal conditions,growth hormone(GH) potently stimulates insulin-like growth factor1(IGF-1) expression and secretion in liver[2].Under low-nutrition states,including acute fasting and chronic caloric restriction (CR),IGF-1becomes greatly suppressed,whereas GH increases [3–5].An increase in GH is part of counter-regulatory responses for glucose homeostasis,whereas a decrease in IGF-1diverts nutrient requirement for development to main-tain normal cell function and enhance survival[6,7].However, the underlying mechanism for this apparent GH resistance, that is,increased GH but decreased IGF-1,remains unclear.

IGF-1,produced predominantly by the liver,plays a vital role in various physiological and pathological processes [8–10],including muscle development[11],bone growth [12,13],glucose metabolism[14,15],and aging[16].GH is a major endocrine hormone that stimulates hepatic IGF-1 expression via Janus kinase2/signal transducer and activator of transcription5(JAK2/STAT5)signaling pathway[17,18].JAK2 is a non-receptor tyrosine kinase,which phosphorylates and activates STAT5,leading to its dimerization and translocation to the nucleus,where it binds to the regulatory elements of IGF-1 and promotes the expression and production of IGF-1[19–21].

In addition to GH,nutrients,such as dietary protein and amino acids,are necessary to maintain circulating IGF-1 [18,22,23].The deficiency of some essential amino acids in rodents or a low protein intake in humans reduces serum IGF-1levels[5,24].Although the concentration of most of serum amino acids decreases,changes in hepatic amino acid levels under malnourished conditions are inconsistent.A recent study showed that hepatic lysine and glycine concen-trations increase after overnight starvation,whereas arginine (Arg)and alanine(Ala)concentrations decrease by58.3%and 50.8%,respectively[25].This finding suggests that some crucial amino acids,especially Arg,are probably associated with malnutrition-induced hepatic IGF-1suppression[25].

Arg is an important conditional essential amino acid[26], which possesses various metabolic and regulatory roles,such as promoting the growth and development of animals, stimulating muscle protein synthesis[27],enhancing cell division[28]and wound healing[28],and regulating inflammatory processes[29–31].These effects are at least partly due to the ability of Arg to activate mammalian target of rapamycin(mTOR).mTOR is an important signaling hub that regulates cellular growth,proliferation,and protein synthesis and acts as a master nutrient controller that senses the intake and deficiency of various amino acids,especially Arg,a known key activator of mTORC1[32–34].

This study aimed to examine whether Arg contributes to GH resistance during fasting.We found that Arg promoted hepatic IGF-1expression and secretion and alleviated malnutrition-induced growth restriction in C57BL/6J mice. These phenomena were mediated by inhibiting the interac-tion between TLR4-mediated inflammation and JAK2/STAT5 signaling pathway.These findings indicated the crucial role of Arg in malnutrition-induced hepatic IGF-I suppression and growth arrest.Providing a therapeutic potential of malnutri-tion with Arg or TLR4inhibitor.

2.Materials and Methods

2.1.Animal Studies

The experimental procedures and methods described in this study were approved by the College of Animal Science,South China Agricultural University.All experiments were conducted in compliance with“The Instructive Notions with Respect to Caring for Laboratory Animals”issued by the Ministry of Science and Technology of the People's Republic of China.C57BL6/J mice were purchased from the Animal Experiment Center of Guangdong Province[permission number:SYXK(Canton)2013-0002].Liver-specific TLR4-KO mice(TLR4?/?-Alb-Cre)were generated by crossing B6(Cg)-Tlr4tm1.1Karp/J and B6·FVB(129)-Tg(Alb1-cre)1Dlr/J mice(The Jackson Laboratory).All mice were housed in individual cages and were given access to standard pellets(crude protein18%,crude fat4%,and crude ash8%)before the experimental period and maintained under constant light for12h and a12h dark cycle at a temperature of23°C±3°C and relative humidity of70%±10%throughout the experimen-tal period.

In the fasting experiment,six-week-old male mice were fasted overnight,then injected(i.p.)with 1.6g/kg Arg or equimolar Ala for1h before sacrificed.Blood samples and liver tissues were collected for further analysis.

In the caloric restriction experiment,twenty twelve-week-old male littermates were received60%of the average value of food intake for18days.Arg was supplemented by drinking water(1.5%,pH7.0).The water was replaced three times a week and body weight was checked every three days.At the end of the experiment,mice were sacrificed to collect blood samples and liver tissue for further testing.

In the acute experiment,six-week-old male littermates were divided into three groups and injected(i.p.)with saline, 0.8g/kg and1.6g/kg of Arg(Sigma)for1h,respectively.To explore the underlying mechanism of Arg action in vivo,mice were injected(i.p.)with vehicle control,Arg(1.6g/kg,1h), drugs(mTOR inhibitor rapamycin,Sigma,Shanghai,China, 5mg/kg,5h;JAK2inhibitor AZD1480,Selleck,Shanghai, China,30mg/kg,3h;LPS,Sigma,100μg/kg,19h and4h, twice)or Arg+drugs.Then mice were sacrificed(about

11

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L79(2018)10–23

5:00pm)to collect blood samples and liver tissues for further analysis.

In the TLR4overexpression experiment,mice were injected(i.v.)with2μg/g plasmids(pCMV-NC-GFP and pCMV-mTLR4-GFP,Hanheng Biotechnology,Shanghai, China)in7s.3days after injection,TLR4overexpression in liver was identified and the mice were injected(i.p.)with saline or Arg(1.6g/kg)for1h before sacrificed.Blood samples and liver tissues were collected for further analysis.

In liver-specific TLR4knockout experiments,homozygous B6(Cg)-Tlr4tm1.1Karp/J mice(TLR4+/+,used as WT control)and TLR4?/?-Alb-Cre mice were also subjected to acute injection (saline or1.6g/kg,1h)or caloric restriction(60%CR,1.5%Arg supplemented in water,21days)as before.Blood,liver, gastrocnemius muscle,soleus muscle,subcutaneous fat, epididymal fat and other tissues were collected for further analysis.

2.2.Cell Culture

HepG2cells(ATCC)were purchased from Zhongyuan Co.,Ltd. (Beijing,China)and cultured in high glucose DMEM(GIBCO, Grand Island,NY,USA),supplemented with10%fetal bovine serum(FBS;GIBCO),100U/mL of penicillin sodium,and 100mg/L of streptomycin sulfate(GIBCO)at37°C in a humidified atmosphere that contained5%CO2.

To explore the effect of Arg on IGF-1expression and the underlying mechanism in vitro,HepG2cells were exposed to different concentrations(0,0.2,0.5and1mM)of Arg,or were co-treated with Arg and1μM rapamycin,1nM AZD1480or 1μg/mL LPS for24h.The cells or cell lysis were collected for further analysis.

2.3.RNA Interference

Human TLR4siRNA and negative control were purchased from GenePharma Co.,Ltd.(Shanghai,China).HepG2cells in 6-well culture plates were transfected with TLR4siRNA or negative control using the Lipofectamine2000(Invitrogen, Carlsbad,CA,USA)according to the manufacturer's instruc-tions.The siRNA sequences of TLR4were as follows:TLR4 siRNA:5′-CCU GAA CCC UAU GAA CUU UTT-3′(sense)and5′-AAA GUU CAU AGG GUU CAG GTT-3′(antisense);NC:5′-UUC UCC GAA CGU GUC ACG UTT-3′(sense)and5′-ACG UGA CAC GUU CGG AGA ATT-3′(antisense).

2.4.Western Blot Analysis

Standard methods and procedures of western blot analysis were conducted as we previously described[35].Antibodies were used as follows:rabbit anti-GAPDH,rabbit anti-β-actin and rabbit anti-TLR6(Bioss,Beijing,China),rabbit anti-IGF-1 (Proteintech,Rosemont,CA,USA),goat anti-PTP1B,mouse anti-SOCS3and mouse anti-TLR4(Santa Cruz,Dallas,TX, USA),rabbit anti-phospho-JAK2and anti-JAK2,rabbit anti-phospho-STAT5and anti-STAT5,rabbit anti-phospho-S6and anti-S6,rabbit anti-phospho-IKKα/βand anti-IKKα/β,rabbit anti-Histone H3and rabbit anti-TLR2(Cell Signaling Technol-ogy,Beverly,MA,USA).The primary antibodies were incubat-ed at4°C overnight and followed by the incubations of the appropriate secondary antibody(Bioworld,Nanjing,China) for1h at room temperature.Protein expression was mea-sured using a FluorChem M Fluorescent Imaging System (ProteinSimple,Santa Clara,CA,USA)and normalized to GAPDH orβ-actin expression.

Intranuclear protein of HepG2cells was extracted by nuclear protein extraction kit(BestBio,Shanghai,China) according to the manufacturer's recommendation and further analyzed by western blotting.

2.5.RNA Extraction,Reverse Transcription,and Quantitative RT-PCR

Standard methods and procedures of total RNA extraction, reverse transcription and quantitative RT-PCR were conducted as we previously described[35].Miceβ-actin or human GAPDH were used as a candidate housekeeping gene.PCR reactions were performed in an Mx3005p instrument(Stratagene,La Jolla, CA,USA).All primer sequences are presented in Table1.

2.6.Radiation Immune Assay

IGF-1Radiation immune assay kit was purchased from Jiuding Medical Bioengineering Co.,Ltd.(Tianjin,China). Mice serum IGF-1concentration was measured by GC-1200 Gamma RIA counter(Zhongke zhongjia Instruments,Inc., Anhui,China)according to the manufacturer's recommenda-tion.Total serum IGF-1was detected after an acid-alkali treatment procedure of serum.

2.7.Co-Immunoprecipitation

Lysates containing500μg total protein were immunoprecipitated with antibodies specific to JAK2(CST)overnight at4°C.Immune complexes were collected by incubation with a mixture of protein A-and G-Sepharose(Beyotime Biotechnology,Shanghai,China)for 6h at4°C;the immune complexes were then washed three times with wash buffer[50mM HEPES-NaOH(pH7.6),150mM NaCl,and 0.1%Triton X-100]before being eluted in2×sodium dodecyl sulfate sample buffer.The immune complexes were subjected to SDS-PAGE and transferred to a polyvinylidene difluoride membrane for further protein detection.

2.8.STAT5Translocation

Cell climbing slices were rinsed3times in PBS,fixed in paraformaldehyde for10min and washed in0.4%Triton X-100(Sigma)for30min then blocked for1h at room temperature.Subsequently,the slices were incubated overnight in rabbit anti-STAT5(CST)at4°C.The next day,the slices were incubated in FITC second antibody(Bioss)for1h and then incubated in PI(Bioss)for10mins.HepG2cells were then observed and the fluorescence were quantified using Nikon Eclipse Ti-s microscopy with Nis-Elements BR software(Nikon Instruments, Japan).Up to six fields of view were captured from every groups.

2.9.Flow Cytometry

Single cell suspensions of HepG2cells were fixed with4%PFA on ice for10min.Cells were then washed in cold PBS and

12M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L79(2018)10–23

incubated with the primary antibody or isotype control for 1h on ice,washed,and then incubated with secondary antibody for 1h on ice.Flow cytometry analysis was performed using MoFlo XDP flow cytometer (Beckman,USA).

2.10.Electrochemiluminescence

The concentration of mice serum IL-1βwere detected by V-PLEX Mouse IL-1βKit and QuickPlex SQ 120(Meso Scale Discovery,USA)according to the manufacturer's recommendation.

2.11.Arg Pull Down Test

Mice liver lysis was incubated with biotin-(PEG)4-R (ChinaPeptides,Shanghai,China)overnight,then the com-plex was pulled down by streptavidin (magnetic bead conjugate)(CST)according to the manufacturer's recommen-dation and subsequently detected by western blot with primary antibodies of TLR2,TLR4and TLR6.

2.12.Fluorescence Resonance Energy Transfer Assay

HepG2cells in 6-well culture plates were transfected with plasmids (pCMV-hTLR4or control vector,GenePharma,Shanghai,China)using the Lipofectamine 2000according to the manufacturer's instructions.After 6h transfection,HepG2cells were exposed to 0.1mM biotin-(PEG)4-R or co-treated with 0.1mM Arg and 0.1mM biotin-(PEG)4-R.Then the cell climbing slices were rinsed 3times in PBS,fixed in paraformaldehyde for 10min and incubated with streptavidin conjugated Cy3antibody (Bioss)for 30min.To measure FRET,the samples were excited at 488nm,and the fluorescence intensities of the donor (GFP)and acceptor (Cy3)

were measured using an appropriate filter set.Image pro-cessing was performed with Nis-Elements BR software.

2.1

3.Statistical Analysis

All experiments were independently repeated at least 3times.The data are expressed as means ±standard error of the mean (SEM).Significant differences between the control and the treated group were determined by Student's t -test.One-way ANOVA with post hoc Tukey test was used to test the dosage effect of Arg and two-way ANOVA was used to test the difference in body weight change of CR experiments (SPSS 20.0,Chicago,IL,USA).All graphs were plotted with GraphPad Prism 6.01(GraphPad software,San Diego,CA,USA).*P <0.05,**P <0.01and ***P <0.001represented significant differences.

3.Results

3.1.Arg Ameliorates Malnutrition-Induced Body Weight Loss and Promotes Hepatic IGF-1Expression and Secretion In Vivo and In Vitro

To clarify whether Arg regulates hepatic IGF-1expression and secretion under malnutrition condition,mice were fasted overnight and injected with Ala or Arg 1h before being euthanized.As expected,compared with the fed group,hepatic IGF-1expression (Fig.1A)and serum IGF-1level (Fig.1B)were greatly decreased after fasting.Interestingly,Arg,but not Ala,remarkably restored the decreased serum IGF-1level (Fig.1C).Although Arg did not affect the body weight gain or body composition of mice fed with chow diet (Fig.S1),Arg potently increased hepatic IGF-1expression and secretion and

Table 1–PCR primer sequences of related genes.Gene abbreviation

Primer sequence (sense/anti-sense)

Product length (bp)

h-IGF-1CATGTCCTCCTCGCATCTCT AGCAGCACTCATCCACGATA 212m-IGF-1CTGGACCAGAGACCCTTTGC GGACGGGGACTTCTGAGTCTT 269h-GAPDH ACGCATTTGGTCGTATTGGG TGATTTTGGAGGGATCTCGC 231m-GAPDH AGCTACTCGCGGCTTTACG ATCCGTTCACACCGACCTTC 246h-PTP1B TCCCTTTGACCATAGTCGGAT GTGACCGCATGTGTTAGGCA 133m-PTP1B GGAACTGGGCGGCTATTTACC CAAAAGGGCTGACATCTCGGT 117h-SOCS3GTCATTGGAGAGGCTGGACT CTGTCCAGCCCAATACCTGA 197m-SOCS3ATGGTCACCCACAGCAAGTTT TCCAGTAGAATCCGCTCTCCT 145h-IL-1βATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA 132m-IL-1βGCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT

89h-IL-6ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG 149m-IL-6CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG 131h-IL-10GTTCTTTGGGGAGCCAACAG GCTCCCTGGTTTCTCTTCCT 155m-IL-10GCTCTTACTGACTGGCATGAG CGCAGCTCTAGGAGCATGTG 105h-TNF-αAGGACCAGCTAAGAGGGAGA CCCGGATCATGCTTTCAGTG 173m-TNF-αGACTCAAATGGGCTTTCCGA TCCAGCCTCATTCTGAGACAGAG 103m-GHRH CTGAGCAGAACCTCAATCGGA GCATCCTGAAGGGAGGTGAG 149m-SST GAAGATGCTGTCCTGCCGTC AGAAACTGACGGAGTCTGGG 108m-GH

GGGTCGAGGAAAACAGGTAGG ATGTAGGCACGCTCGAACTC 298

m-TLR4-flox-mut

TGACCACCCATATTGCCTATAC TGATGGTGTGAGCAGGAGAG

234/285m-Alb-Cre-Transgene

CCAGGCTAAGTGCCTTCTCTACA AATGCTTCTGTCCGTTTGCCGGT

500m-Alb-Cre-Internal Positive Control CTAGGCCACAGAATTGAAAGATCT GTAGGTGGAAATTCTAGCATCATCC 324m-TLR4-KO authentication

GCTTTGACTTGAGGCAGTCC CAAGGACAACAGCACACCAA

200

“m ”represents mouse and “h ”represents human.

13

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

Fig.1–Effect of Arg on hepatic IGF-1expression and secretion.Thirty-two 6-week-old mice were randomly divided into four groups (n =6–10).After ad libitum or starvation for 24h,mice were intraperitoneally (i.p.)injected with 1.6g/kg Arg or equimolar Ala.(A –B).Hepatic IGF-1expression level detected through Western blot.(C)Serum IGF-1concentration detected by RIA.Twenty-four 12-week-old mice were randomly divided into two groups (n =12)and given diet of approximately 60%average daily food intake for 18days.1.5%Arg was supplemented via drinking water.(D)Mice body weight loss.(E)Hypothalamus GHRH and SST,pituitary GH,and hepatic IGF-1mRNA expression levels detected by qRT-PCR.(F –G)Expression level of hepatic IGF-1detected by Western blot.(H)Serum IGF-1concentration detected by RIA.HepG2cells were exposed to different concentrations (0,0.2,0.5,and 1mM)of Arg for 24h.(I)Hepatic IGF-1mRNA expression levels detected by qRT-PCR.(J)Intracellular IGF-1level detected by FCM.Eighteen 6-week-old mice were randomly divided into three groups (n =6)and injected with different concentrations (0,0.8,and 1.6g/kg)of Arg for 1h.(K)Hepatic IGF-1mRNA expression levels detected by qRT-PCR.(L)Serum IGF-1concentration detected by RIA.(M –N)Expression level of hepatic IGF-1detected by Western blot.(O \P)Phosphorylation level of gastrocnemius mTOR and ERK detected by Western blot.Data are presented as mean ±SEM.Significant differences between the control group and the treated group were determined by Student's t-test.*means P <0.05compared with that of the control.One-way ANOVA with post hoc Tukey's test was conducted to analyze the effect of Arg dosage.Two-way ANOVA was performed to evaluate the effect of Arg on body weight change under CR condition.GAPDH and β-actin served as housekeeping genes.

14

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

significantly ameliorated CR-induced body weight loss under chronic CR condition (Fig.1D –H and Fig.S2A).No evident change was observed in body composition (Fig.S2B).Notably,the mRNA expression levels of hypothalamic growth hormone-releasing hormone (GHRH),somatostatin (SST),and pituitary GH remained unchanged.These findings indicated a direct effect of Arg on hepatic IGF-1expression and secretion.

To describe the effect of Arg,we i.p.treated the HepG2cell lines and the C57BL/6J mice with different Arg concentrations.IGF-1expression levels increased in HepG2cells exposed to 1mM Arg for 24h (Fig.1I and Figs.S3A \S3B).Flow cytometry data also illustrated that the fluorescence intensity,which reflects intracellular IGF-1level,was higher in the Arg-treated group than in the control HepG2cells (Fig.1J).The mRNA and protein expression levels of hepatic IGF-1significantly increased in a dose-dependent manner,and the serum IGF-1level remarkably increased 1h post Arg injection in mice (Fig.1K –N and Fig.S3C).However,Arg failed to further increase the serum IGF-I level under fed condition (Fig.S3D).Moreover,the phosphorylation level of the downstream signal of IGF-1receptors,ERK,and mTOR,were significantly enhanced in mice gastrocnemius muscle (Fig.1O –P).These results revealed that Arg is sufficient to promote hepatic IGF-1expression and secretion under in vitro and in vivo conditions.

Role of mTOR in Arg-induced hepatic IGF-1expression and secretion mTOR is known as a key downstream mediator of Arg.In this study,the phosphorylation of mTOR was increased

in mouse liver after Arg injection (Fig.2A-B),thereby suggesting that mTOR might play a key role in Arg-induced IGF-1expression and secretion.To determine whether the mTOR signal participates in Arg-induced hepatic IGF-1expression and secretion,we treated the mice with Arg alone or in combination with rapamycin,an mTOR inhibitor.Consistent with earlier observations,our results revealed that Arg increased the hepatic IGF-1expression and secretion (Fig.2C –F),but rapamycin failed to block the effect of Arg on IGF-1(Fig.2C –F).These alterations also occurred in HepG2cells (Fig.S4).These data demonstrated that mTOR was not involved in Arg-induced hepatic IGF-1expression and secretion.

3.2.Effect of Arg on JAK2-STAT5Signaling Pathway

The JAK2/STAT5signaling pathway regulates IGF-1transcription [21].The phosphorylation levels of hepatic JAK2and STAT5were decreased under fasting conditions (Fig.3A –B).Interestingly,they were significantly increased by Arg (Fig.3C –D).Results from Co-IP experiments showed that the interaction between JAK2and STAT5was increased after Arg administration in mouse liver and HepG2cells (Fig.3E –F).Arg treatment consistently increased STAT5translocation to the nuclei in HepG2cells (Fig.3G).The intra-nuclear STAT5level in the Arg group was significantly higher than those of the control groups (Fig.3H).These findings suggested that the JAK2/STAT5signaling pathway contributed to Arg-induced hepatic IGF-1expression and

secretion.

Fig.2–Role of mTOR in Arg-induced hepatic IGF-1expression and secretion.Mice were injected with different concentrations (0,0.8,and 1.6g/kg)of Arg for 1h.(A –B)Phosphorylation level of hepatic mTOR detected through Western blot.Twenty-four 6-week-old mice were randomly divided into four groups (n =6)and injected with mTOR inhibitor rapamycin (5mg/kg)for 5h and/or Arg (1.6g/kg)for 1h.(C)Serum IGF-1concentration detected by RIA.(D)mRNA expression levels of hepatic IGF-1detected by qPCR.(E –F)Phosphorylation level of S6and expression level of IGF-1detected by Western blot.Data are presented as mean ±SEM.Significant differences between the control group and the treated group were determined with Student's t -test.*and #mean P <0.05compared with those of the control and Rap.groups,respectively.One-way ANOVA with post hoc Tukey's test was conducted to analyze the effect of Arg dosage.GAPDH served as a housekeeping gene.

15

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

3.3.JAK2/STAT5Signaling Pathway Mediates Arg-Induced Hepatic IGF-1Expression and Secretion

To further determine whether the JAK2/STAT5signaling path-way mediates Arg-induced hepatic IGF-1expression and secre-tion,AZD1480,a specific and efficient inhibitor of JAK2,was used to block the signaling transduction of JAK2.The expression and secretion of hepatic IGF-1induced by Arg were effectively blocked by AZD1480in HepG2cells (Fig.4A –B),in mouse liver preparation (Fig.4G –I),and in the phosphorylation and translocation of STAT5in HepG2cells (Fig.4C –D).To test the role of GH in Arg-stimulated JAK2/STAT5signaling pathway activation,HepG2cells were co-treated with Arg and GH.The activity of JAK2/STAT5signaling pathway and the expression of IGF-1were promoted by Arg and GH,which were further enhanced in the co-treatment group compared with that of GH or Arg solo-treatment group (Fig.4E –F).These observations demonstrated that Arg promoted IGF-1expression by enhancing JAK2/STAT5pathway activity.

3.4.Inflammatory Pathway Involved in Arg-induced Hepatic IGF-1Expression and Secretion

Recent studies report that protein tyrosine phosphatase 1B (PTP1B)and the suppressor of cytokine signaling 3(SOCS3),known to be activated by inflammatory responses [36],partic-ipate in the downregulation of JAK2/STAT5signaling pathway activity [36,37].Interestingly,the expression levels of hepatic

PTP1B and SOCS3were decreased after fasting (Fig.5A –B),which were in accordance with that of the suppressed JAK2/STAT5signaling pathway (Fig.3A –B).Thus,we further investi-gated the effect of Arg on the inflammatory responses and expression of PTP1B and SOCS3.The mRNA levels of pro-inflammation factors (IL-1β,IL-6,and TNF α)were downregu-lated,whereas those of anti-inflammation factors (IL-10)were upregulated (Fig.5C and Fig.S5A).The serum IL-1βlevel was consistently decreased by Arg injection (Fig.5D).Meanwhile,the expression levels of PTP1B and SOCS3and the phosphory-lation levels of the inhibitor of nuclear factor kappa-B kinase α/β(IKK α/β),a marker of inflammatory pathways,were significant-ly reduced in the Arg-treated group (Fig.5C,E,and F).In addition,results from Co-IP experiments showed that interac-tions between JAK2and PTP1B or SOCS3were reduced in mouse liver or the HepG2cells of the Arg group compared with that in the control group (Fig.5G and Fig.S5B).

To further verify whether the inflammatory pathway is involved in Arg-induced hepatic IGF-1expression and secretion,mice were injected with lipopolysaccharide (LPS),a known inducer of inflammation.LPS effectively abolished the effects of Arg on the expression of PTP1B and SOCS3,hepatic JAK2/STAT5signaling pathway,and IGF-I expression and secretion (Fig.5H –J).Similarly,Arg-induced STAT5translocation in HepG2cells was also blocked by LPS (Fig.5K and L).These results suggested that the inflamma-tory pathway contributes to Arg-induced hepatic JAK2/STAT5activation and IGF-1expression and

secretion.

Fig.3–Effect of Arg on JAK2-STAT5signaling pathway activation.Mice were free to food or fasted for 24h.(A –B)Phosphorylation levels of hepatic JAK2and STAT5detected by Western blot.Mice were injected with saline or Arg (1.6g/kg)for 1h.(C –D)Phosphorylation levels of hepatic JAK2and STAT5detected by Western blot.(E)Combination between hepatic JAK2and STAT5detected by co-IP.HepG2cells were exposed to 0or 1mM Arg for 24h.(F)Combination between JAK2and STAT5detected by co-IP.(G)STAT5translocation detected by ICC.(H)Expression of STAT5in nuclei and cytoplasm detected by Western blot.Data are presented as mean ±SEM.*means P <0.05compared with that of the control.GAPDH and Histone-H3served as housekeeping genes.

16

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

3.5.TLR4-Mediated Inflammatory Pathway Inhibits Hepatic JAK2/STAT5Signaling Pathway Activation and Suppresses IGF-1Expression and Secretion

TLRs are a class of pattern recognition receptors,which initiate the activation of inflammatory pathways [38].To identify whether TLRs in hepatocyte membrane physically interact with Arg,we performed a pulldown experiment with biotin-conjugated Arg.The results showed that TLR4,not TLR2or TLR6,was in the same complex with Arg (Fig.6A).The FRET assay also displayed a distinct binding between TLR4and biotin-conjugated Arg compared with that of the control.This combination was attenuated by Arg,thereby indicating that a competitive binding of Arg and biotin-conjugated Arg with TLR4occurred (Fig.6B).To investigate the role of TLR4in hepatic JAK2/STAT5/IGF-1pathway expression,we trans-ferred HepG2cells with TLR4siRNA and knocked down its gene expression.When TLR4was silenced in HepG2cells (Fig.6C),the phosphorylation level of IKK α/βand the expression level of PTP1B and SOCS3were significantly reduced,whereas the phosphorylation level of JAK2and STAT5and the expression level of IGF-1were increased.However,Arg did not further elicit its effect when TLR4was knocked down (Fig.6D –E).We also generated mice with overexpressed TLR4s in the liver through i.v.injection of TLR4-OE plasmid (pCMV-TLR4-GFP)and the control mice injected with pCMV-NC-GFP.The IHC images and Western blot analysis displayed that both plasmids were successfully expressed in the liver (Fig.6F –H).In these mice,

Arg

Fig. 4 – JAK2/STAT5 signaling pathway mediates Arg-induced hepatic IGF-1 expression and secretion. HepG2 cells were exposed to JAK2 inhibitor AZD1480 (1 μM) or co-treated with Arg (1 mM) for 24 h. (A –B) Phosphorylation level of STAT5 and expression level of IGF-1 detected by Western blot. (C) Expression of STAT5 in nuclei and cytoplasm detected by Western blot.(D) STAT5 translocation detected by ICC. HepG2 cells were exposed to GH (20 nM) or co-treated with Arg (1 mM) for 24 h. (E –F) Phosphorylation levels of JAK2 and STAT5 and expression level of IGF-1 detected by Western blot. Twenty-four 6-week-old mice were randomly divided into four groups (n = 10) and injected with AZD1480 (30 mg/kg) for 3 h and/or Arg (1.6 g/kg) for 1h.(G –H) Phosphorylation level of STAT5 and expression level of IGF-1 detected by Western blot. (I) Serum IGF-1 concentration detected by RIA. Data are presented as mean ± SEM. * and # mean P < 0.05 compared with those of the control and GH groups, respectively. GAPDH and Histone-H3 served as housekeeping genes.

17

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

affected the inflammatory and JAK2/STAT5pathway and the IGF-I expression and secretion (Fig.6I –K).These data showed that the TLR4-mediated inflammatory pathway inhibits the activation of the hepatic JAK2/STAT5signaling pathway and suppresses the expression and secretion of IGF-1.

3.6.TLR4-specific Knockout in the Liver Promotes Growth and Hepatic IGF-1Expression and Secretion

To verify the effect of TLR4on hepatic IGF-1expression and secretion,we generated TLR4liver-specific knockout mice (TLR4?/?-Alb-Cre )(Fig.7A).The basal level of serum IGF-1was increased in TLR4?/?-Alb-Cre mice (Fig.7B),and a reduced serum glucose level was detected (Fig.7C).Similar to the TLR4RNAi experiment,liver-specific TLR4knockout effectively

abolished the effects of Arg on the inflammatory and JAK2/STAT5signaling pathway and the IGF-I expression (Fig.7D –E).

When subjected to CR,these mice exhibited an attenuated body weight loss,increased serum IGF-1level,and reduced serum glucose level compared with those of the WT control mice (Fig.7F –I).The effects of Arg were also abolished under the CR condition.However,serum GH levels were consistent under CR or Arg treatment (Fig.S6).These data indicated an important role of TLR4on Arg-induced hepatic IGF-1expres-sion and secretion possibly because of the enhanced growth hormone receptor (GHR)sensitivity.In addition,both Arg and liver-specific TLR4knockout tend to increase muscle weight but not adipose tissue weight (Fig.7J),and this finding might indicate that Arg maintains body weight by reducing muscle

wasting.

Fig. 5 – Inflammatory pathway involved in Arg-induced hepatic IGF-1 expression and secretion. Mice were free to food or fasted for 24 h. (A –B) Expression levels of PTP1B and SOCS3 detected by Western blot. Mice were injected with saline or Arg (1.6 g/kg) for 1 h. (C) Relative mRNA expression levels detected by qRT-PCR. (D) Serum IL-1β concentration detected by MSD.(E –F) Phosphorylation level of IKK α/β and expression levels of PTP1B and SOCS3 detected by Western blot. (G) Combination between hepatic JAK2 and PTP1B or SOCS3 detected by co-IP. Twenty-four 6-week-old mice were randomly divided into four groups (n = 6) and injected with LPS (100 μg/kg) for 19 h/4 h (twice) and/or Arg (1.6 g/kg) for 1 h. (H) Serum IGF-1 concentration detected by RIA. (I –J) Phosphorylation levels of JAK2 and STAT5 and expression levels of PTP1B, SOCS3, and IGF-1 detected by Western blot. HepG2 cells were exposed to LPS (1 μg/mL) or co-treated with Arg (1 mM) for 24 h. (K) Expression level of STAT5 in nuclei and cytoplasm detected by Western blot. (L) STAT5 translocation detected by ICC. Data are presented as mean ± SEM. * means P < 0.05 compared with that of the control. GAPDH and Histone-H3 served as housekeeping genes.

18

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

4.Discussion

Body weight loss is highly associated with the morbidity of elderly and children [39–41]and the mortality of patients with cancer-induced cachexia [42]or patients with critical illnesses in intensive care units [43].In patients suffering from diseases or malnutrition,slight body weight loss substantially worsens their survival rates and vice versa [44,45].However,GH treatment increases the mortality of critically ill adults [43,46].Thus,other alternative options are necessary to facilitate the treatment of cachexia or critically ill patients.Critical illness or malnutrition induces body weight loss and growth retardation largely because of IGF-1deficiency and GH resistance [3,47–49].Previous studies showed a remarkable decline of Arg and Ala during fasting [25].In our study,Arg,not Ala,alleviated fasting-or CR-induced IGF-1deficiency and body weight loss,thereby indicating a curial role of Arg in regulating hepatic IGF-1expression and secretion during

malnutrition but not under fed condition (Fig.S3D).Our data suggested that Arg serves as a conditional essential amino acid under malnutrition to attenuate inflammation and maintain GH https://www.sodocs.net/doc/f71736318.html,ing Arg as an alternative medicine for GH in the therapy of patients with cancer/cachexia and critical illness is promising because Arg can reverse GH resistance,promote IGF-1expression and secretion,ameliorate malnutrition-induced body weight loss,and suppress pro-inflammatory pathways.

The mechanism of Arg-dependent mTOR regulation has been elucidated [32–34].Arg cooperates with growth factors to prevent the interaction between TSC and Rheb on lysosomes,which allow the interaction between Rheb and mTORC1,thereby activating mTOR [32].In general,mTOR is a down-stream signaling molecule of the IGF-1/IR/PI3K/Akt signaling pathway.However,whether mTOR mediates the action of Arg on hepatic IGF-1expression is uncertain.Our previous study demonstrated that AA (combination of multiple amino acids)-induced PPAR γand IGF-1expression levels are

effectively

Fig. 6 – TLR4-mediated inflammatory pathway inhibits hepatic JAK2/STAT5 signaling pathway activation and suppresses IGF-1 expression and secretion. Mouse liver lysis was incubated with biotin-(PEG)4-R overnight. Then, the complex was pulled down by magnetic bead-conjugated streptavidin and subsequently detected with the primary antibodies of TLRs. (A) TLR2, TLR4, and TLR6 detected through Western blot. PC represents positive control. HepG2 cells were transferred with pCMV-hTLR4-GFP plasmid for 6 h and then treated with 0.1 mM biotin-(PEG)4-R or co-treated with 0.1 mM Arg and 0.1 mM biotin-(PEG)4-R. (B) Binding validation of Arg and TLR4 detected by FRET. HepG2 cells were transferred with negative control or TLR4 siRNA for 6 h and then treated with Arg (1 mM) for 24 h. (C) Interference efficiency of TLR4 detected by qRT-PCR. (D –E) Phosphorylation and expression levels of related proteins detected by Western blot. Mice were injected (i.v.) with 1 mg/kg vector control (pCMV-NC-GFP) or pCMV-mTLR4-GFP for 3 days and then injected (i.p.) with saline or Arg (1.6 g/kg) for 1 h. (F) Representative pictures of liver tissue sections. (G –H) Validation of TLR4 overexpression in mouse liver through Western blot. (I) Serum IGF-1 concentration detected by RIA. (J –K) Phosphorylation and expression levels of related proteins detected by Western blot. * means P <0.05 compared with that of the control. GAPDH served as a housekeeping gene.

19

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

reversed by rapamycin,and the interaction between mTOR and PPAR γis involved in AA-induced IGF-1expression in HepG2cells [50].In our present study,Arg-induced hepatic IGF-1expression and secretion are not mediated by mTOR,suggesting that the effect of mTOR on IGF-1expression is promoted by amino acids other than Arg.

IGF-1secretion is controlled by GH concentration and its sensitivity,thereby indicating the ability of GH to activate the downstream JAK2/STAT5signaling pathway.GHR sensitivity declines during malnutrition,such as fasting [7].In our study,liver JAK2/STAT5signaling pathway and serum IGF-I levels decreased after the mice completed fasting and alleviated by Arg supplementation.However,Arg failed to regulate hypothalamus-pituitary growth axis-related gene expression in the CR model.Arg promotes pituitary GH secretion directly [51,52]or synergistically with hypothalamus SST [53]and GHRH [54].The discrepancy of the effect of Arg on GH expression might be related to the nutrition status of mice.To address the direct effect of Arg on hepatic IGF-I expression,we adopted the HepG2cell model and found that Arg activated the JAK2/STAT5signaling pathway in the absence of GH.Interestingly,the similar activation effect of GH was further enhanced after Arg treatment was administered.Therefore,Arg stimulates the JAK2/STAT5signaling pathway by enhancing GHR sensitivity.

Inflammatory responses are a key process to influence JAK2/STATs signaling pathways and GH sensitivity,which are associated with two negative regulatory factors,PTP1B and SOCS3[55].These two proteins inhibit the JAK2/STAT5signaling pathway activation by binding to JAK2and induce de-phosphorylation or suppress the signal transmission of JAK2[36,56].Arg holds a key position in the cellular functions and interactions that occur during inflammation and immune responses [57,58].A recent study suggested that Arg

relieved

Fig. 7 – TLR4 knockout specific in liver ameliorates malnutrition-induced body weight loss and promotes IGF-1 expression and secretion. 6-week-old liver-specific TLR4 knockout (TLR4?/?-Alb-Cre ) mice and WT (TLR4+/+) mice (n = 6) were injected with saline or Arg (1.6 g/kg) for 1 h. (A) Validation of TLR4 knockout in different tissues detected by qRT-PCR. (B) Serum IGF-1 concentration detected by RIA. (C) Serum glucose concentration. (D –E) Phosphorylation and expression levels of related proteins detected by Western blot. Twelve-week-old WT and TLR4-lKO mouse liver were given diet of approximately 60%average daily food intake for 21 days. 1.5% Arg was supplemented via drinking water. (F) Mice body weight loss. (G) Two-way ANOVA of body weight loss of mice on the 21st day. (H) Serum IGF-1 concentration detected by RIA. (I) Serum glucose concentration. (J) Tissue weights of gastrocnemius, soleus, epididymal fat, and subcutaneous fat. * means P < 0.05 compared with that of the control. GAPDH served as a housekeeping gene.

20

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L 79(2018)10–23

the inflammatory response and enhanced the casein expres-sion in bovine mammary epithelial cells induced by LPS[59]. In the present study,the expression levels of PTP1B and SOCS3in mouse liver were remarkably enhanced after fasting but were reduced by Arg administration.In addition,the inflammation agonist LPS reversed the effects of Arg on PTP1B and SOCS3expression,JAK2/STAT5signaling pathway,and IGF-I expression and secretion.Thus,inflammation response is involved in the ability of Arg to enhance GH sensitivity.

TLRs,members of pattern recognition receptor family,are sensor molecules that initiate innate immune responses via recognition endogenous or microbial components,such as fatty acids,lipopolysaccharides,lipoproteins,and nucleic acids[60,61].TLRs play a pivotal role in the initiation and progression of a wide range of diseases,such as diabetes mellitus[62],cardiovascular diseases[63],periodontal disease [64],neuro-inflammation[65],inflammatory bowel disease, and colitis-associated carcinogenesis[66].However,whether TLRs participate in Arg-induced hepatic IGF-1expression and secretion remains unclear.Dietary Arg supplementation has been reported to downregulate TLR4and MyD88mRNA expres-sion in the intestinal preparations of weaned piglets[67].In this study,our pull-down tests demonstrated that Arg could bind TLR4but not TLR2or TLR6.In addition,Arg or liver-specific TLR4 knockout alleviates growth restriction under malnutrition by reversing hepatic GH resistance as manifested by increased IGF-1secretion and decreased serum glucose.The striking effects of Arg were attenuated by TLR4knockdown or knockout,indicating an important role of TLR4in mediating Arg activity.These findings warrant more investigations on the roles of TLR4in GH sensitivity and growth restriction,and demonstrates a potential to target the TLR4pathway as therapeutic strategies for IGF-I deficiency or other TLR4associated diseases.

In conclusion,our results demonstrated a novel pathway involving Arg that promoted hepatic IGF-1expression and secretion through the inhibition of TLR4-mediated inflammatory pathway and provided a therapeutic potential for malnutrition,cancer,cachexia,terminal illnesses,IGF-1 deficiency,and other TLR4-associated diseases with an Arg or TLR4inhibitor.

Author Contributions

J.X.,C.Z.,M.Z.,X.W.,X.C,Ya.X.,Y.Y.and Z.L.,carried out all experimental work;L.W.,X.Z.,S.W.,P.G.,Q.X.and Q.J. conducted cell culture,animal studies,western blot,qPCR and other experiments and data analysis.Q.T.,Yo.X.,Q.J.and G.S.designed this experiment;J.X.,Q.T.and G.S.wrote this manuscript.

Acknowledgements

This work was supported by National Basic Research Program of China(2013CB127300to G.Shu and Q.Jiang),National Natural Science Foundation of China(3179410034to Q.Jiang and31572480to G.Shu)and National Key Point Research and Invention Program(2016YFD0501205to G.Shu).Conflict of Interest

The authors declare no competing financial interests. Appendix A.

Supplementary Data

Supplementary data to this article can be found online at https://https://www.sodocs.net/doc/f71736318.html,/10.1016/j.metabol.2017.10.006.

R E F E R E N C E S

[1]Gat-Yablonski G,Pando R,Phillip M.Nutritional catch-up

growth.World Rev Nutr Diet2013;106:83–9.

[2]Bjornsson BT,Johansson V,Benedet S,Einarsdottir IE,Hildahl

J,Agustsson T,et al.Growth hormone endocrinology of

salmonids:regulatory mechanisms and mode of action.Fish Physiol Biochem2002;27(3–4):227–42.

[3]De W,Ai-rong Z,Yan L,Sheng-yu X,Hai-yan G,Yong Z.Effect

of feeding allowance level on embryonic survival,IGF-1,

insulin,GH,leptin and progesterone secretion in early

pregnancy gilts.J Anim Physiol Anim Nutr2009;93(5):577–85.

[4]Straus DS,Takemoto CD.Effect of fasting on insulin-like

growth factor-I(IGF-I)and growth hormone receptor mRNA levels and IGF-I gene transcription in rat liver.Mol Endocrinol 1990;4(1):91–100.

[5]Parrella E,Maxim T,Maialetti F,Zhang L,Wan J,Wei M,et al.

Protein restriction cycles reduce IGF-1and phosphorylated tau,and improve behavioral performance in an Alzheimer's disease mouse model.Aging Cell2013;12(2):257–68.

[6]Hojlund K,Wildner-Christensen M,Eshoj O,Skjaerbaek C,

Holst JJ,Koldkjaer O,et al.Reference intervals for glucose,

beta-cell polypeptides,and counterregulatory factors during

prolonged fasting.Am J Physiol Endocrinol Metab2001;280(1):E50-8.

[7]Pedersen MH,Svart MV,Lebeck J,Bidlingmaier M,

Stodkilde-Jorgensen H,Pedersen SB,et al.Substrate me-

tabolism and insulin sensitivity during fasting in obese

human subjects:impact of GH blockade.J Clin Endocrinol Metab2017;102(4):1340–9.

[8]Olszanecka A,Dragan A,Kawecka-Jaszcz K,Fedak D,

Czarnecka D.Relationships of insulin-like growth factor-1, its binding proteins,and cardiometabolic risk in hyperten-sive perimenopausal women.Metab Clin Exp2017;69:

96–106.

[9]Ohlsson C,Mohan S,Sjogren K,Tivesten A,Isgaard J,

Isaksson O,et al.The role of liver-derived insulin-like growth factor-I.Endocr Rev2009;30(5):494–535.

[10]Sadaba MC,Martin-Estal I,Puche JE,Castilla-Cortazar I.

Insulin-like growth factor1(IGF-1)therapy:mitochondrial

dysfunction and diseases.Biochim Biophys Acta2016;

1862(7):1267–78.

[11]Shavlakadze T,Chai JF,Maley K,Cozens G,Grounds G,Winn

N,et al.A growth stimulus is needed for IGF-1to induce

skeletal muscle hypertrophy in vivo(vol123,pg960,2010).J Cell Sci2013;126(19)(4536–4536).

[12]Yakar S,Rosen CJ,Beamer WG,Ackert-Bicknell CL,Wu Y,Liu

JL,et al.Circulating levels of IGF-1directly regulate bone

growth and density.J Clin Invest2002;110(6):771–81.

[13]McMichael BK,Jeong YH,Auerbach JA,Han CM,Sedlar R,

Shettigar V,et al.The RhoGAP Myo9b promotes bone growth by mediating osteoblastic responsiveness to IGF-1.J Bone

Miner Res2017;32(10):2103–15.

21

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L79(2018)10–23

[14]Clemmons DR.Involvement of insulin-like growth factor-I in

the control of glucose homeostasis.Curr Opin Pharmacol2006;

6(6):620–5.

[15]De Ita JR,Castilla-Cortazar I,Aguirre GA,Sanchez-Yago C,

Santos-Ruiz MO,Guerra-Menendez L,et al.Altered liver

expression of genes involved in lipid and glucose metabolism in mice with partial IGF-1deficiency:an experimental

approach to metabolic syndrome.J Transl Med2015;13:326.

[16]Junnila RK,List EO,Berryman DE,Murrey JW,Kopchick JJ.The

GH/IGF-1axis in ageing and longevity.Nat Rev Endocrinol

2013;9(6):366–76.

[17]Gan Y,Buckels A,Liu Y,Zhang Y,Paterson AJ,Jiang J,et al.

Human GH receptor-IGF-1receptor interaction:implications for GH signaling.Mol Endocrinol2014;28(11):1841–54.

[18]Puche JE,Castilla-Cortazar I.Human conditions of insulin-

like growth factor-I(IGF-I)deficiency.J Transl Med2012;10: 224.

[19]Rotwein P.Mapping the growth hormone—Stat5b—IGF-I

transcriptional circuit.Trends Endocrinol Metab2012;23(4): 186–93.

[20]Uyttendaele I,Lemmens I,Verhee A,De Smet AS,

Vandekerckhove J,Lavens D,et al.Mammalian protein-

protein interaction trap(MAPPIT)analysis of STAT5,CIS,and SOCS2interactions with the growth hormone receptor.Mol Endocrinol2007;21(11):2821–31.

[21]Yamamoto M,Iguchi G,Fukuoka H,Suda K,Bando H,

Takahashi M,et al.SIRT1regulates adaptive response of the growth hormone—insulin-like growth factor-I axis under

fasting conditions in liver.Proc Natl Acad Sci U S A2013;

110(37):14948–53.

[22]Hawkes CP,Grimberg A.Insulin-like growth factor-I is a

marker for the nutritional state.Pediatr Endocrinol Rev2015;

13(2):499–511.

[23]Duncan CA,Jetzt AE,Cohick WS,John-Alder HB.Nutritional

modulation of IGF-1in relation to growth and body

condition in Sceloporus lizards.Gen Comp Endocrinol2015;

216:116–24.

[24]Levine ME,Suarez JA,Brandhorst S,Balasubramanian P,

Cheng CW,Madia F,et al.Low protein intake is associated

with a major reduction in IGF-1,cancer,and overall mortality in the65and younger but not older population.Cell Metab 2014;19(3):407–17.

[25]Holecek M,Sispera L.Effects of arginine supplementation on

amino acid profiles in blood and tissues in fed and overnight-fasted rats.Forum Nutr2016;8(4):206.

[26]Morris CR,Hamilton-Reeves J,Martindale RG,Sarav M,Ochoa

Gautier JB.Acquired amino acid deficiencies:a focus on

arginine and glutamine.Nutr Clin Pract2017;32(1Suppl):

30s–47s.

[27]Paddon-Jones D,Borsheim E,Wolfe RR.Potential ergogenic

effects of arginine and creatine supplementation.J Nutr2004;

134(10Suppl):2888S–94S[discussion2895S].

[28]Tong BC,Barbul A.Cellular and physiological effects of

arginine.Mini Rev Med Chem2004;4(8):823–32.

[29]Lucotti P,Monti L,Setola E,La Canna G,Castiglioni A,

Rossodivita A,et al.Oral L-arginine supplementation improves endothelial function and ameliorates insulin sensitivity and

inflammation in cardiopathic nondiabetic patients after an

aortocoronary bypass.Metab Clin Exp2009;58(9):1270–6. [30]Gogoi M,Datey A,Wilson KT,Chakravortty D.Dual role of

arginine metabolism in establishing pathogenesis.Curr Opin Microbiol2016;29:43–8.

[31]Wijnands KA,Castermans TM,Hommen MP,Meesters DM,

Poeze M.Arginine and citrulline and the immune response in sepsis.Forum Nutr2015;7(3):1426–63.

[32]Carroll B,Maetzel D,Maddocks OD,Otten G,Ratcliff M,Smith

GR,et al.Control of TSC2-Rheb signaling axis by arginine

regulates mTORC1activity.Elife2016;5.[33]Chantranupong L,Scaria SM,Saxton RA,Gygi MP,Shen K,

Wyant GA,et al.The CASTOR proteins are arginine sensors for the mTORC1pathway.Cell2016;165(1):153–64.

[34]Saxton RA,Chantranupong L,Knockenhauer KE,Schwartz

TU,Sabatini DM.Mechanism of arginine sensing by CASTOR1 upstream of mTORC1.Nature2016;536(7615):229–33.

[35]Fang XL,Shu G,Zhang ZQ,Wang SB,Zhu XT,Gao P,et al.

Roles of alpha-linolenic acid on IGF-I secretion and GH/IGF system gene expression in porcine primary hepatocytes.Mol Biol Rep2012;39(12):10987–96.

[36]Babon JJ,Nicola NA.The biology and mechanism of action of

suppressor of cytokine signaling3.Growth Factors2012;30(4): 207–19.

[37]Johnson KJ,Peck AR,Liu C,Tran TH,Utama FE,Sjolund AB,

et al.PTP1B suppresses prolactin activation of Stat5in breast cancer cells.Am J Pathol2010;177(6):2971–83.

[38]O'Neill LA,Golenbock D,Bowie AG.The history of toll-like

receptors-redefining innate immunity.Nat Rev Immunol

2013;13(6):453–60.

[39]Fischer J,Johnson MA.Low body weight and weight loss in

the aged.J Am Diet Assoc1990;90(12):1697–706.

[40]Naseer M,Forssell H,Fagerstrom C.Malnutrition,functional

ability and mortality among older people aged60years:a7-year longitudinal study.Eur J Clin Nutr2016;70(3):399–404. [41]Loeffen EA,Brinksma A,Miedema KG,de Bock GH,Tissing

WJ.Clinical implications of malnutrition in childhood cancer patients—infections and mortality.Support Care Cancer

2015;23(1):143–50.

[42]Suzuki H,Asakawa A,Amitani H,Nakamura N,Inui A.Cancer

cachexia—pathophysiology and management.J

Gastroenterol2013;48(5):574–94.

[43]Takala J,Ruokonen E,Webster NR,Nielsen MS,Zandstra DF,

Vundelinckx G,et al.Increased mortality associated with

growth hormone treatment in critically ill adults.N Engl J

Med1999;341(11):785–92.

[44]Mardas M,Stelmach-Mardas M,Madry R.Body weight

changes in patients undergoing chemotherapy for ovarian

cancer influence progression-free and overall survival.Sup-port Care Cancer2017;25(3):795–800.

[45]Fuji S,Mori T,Khattry N,Cheng J,Do YR,Yakushijin K,et al.

Severe weight loss in3months after allogeneic hematopoi-etic SCT was associated with an increased risk of subsequent non-relapse mortality.Bone Marrow Transplant2015;50(1): 100–5.

[46]Ruokonen E,Takala J.Dangers of growth hormone therapy in

critically ill patients.Curr Opin Clin Nutr Metab Care2002;

5(2):199–209.

[47]Beauloye V,Willems B,de Coninck V,Frank SJ,Edery M,

Thissen JP.Impairment of liver GH receptor signaling by

fasting.Endocrinology2002;143(3):792–800.

[48]Henning PC,Scofield DE,Rarick KR,Pierce JR,Staab JS,

Lieberman HR,et al.Effects of acute caloric restriction

compared to caloric balance on the temporal response of the IGF-I system.Metab Clin Exp2013;62(2):179–87.

[49]Ross R,Miell J,Freeman E,Jones J,Matthews D,Preece M,

et al.Critically ill patients have high basal growth hormone levels with attenuated oscillatory activity associated with

low levels of insulin-like growth factor-I.Clin Endocrinol

(Oxf)1991;35(1):47–54.

[50]Wan X,Wang S,Xu J,Zhuang L,Xing K,Zhang M,et al.

Dietary protein-induced hepatic IGF-1secretion mediated by PPARgamma activation.PLoS One2017;12(3):e0173174. [51]Olinto SC,Adriao MG,Castro-Barbosa T,Goulart-Silva F,

Nunes MT.Arginine induces GH gene expression by activat-ing NOS/NO signaling in rat isolated hemi-pituitaries.Braz J Med Biol Res2012;45(11):1066–73.

[52]Maccario M,Procopio M,Loche S,Cappa M,Martina V,

Camanni F,et al.Interaction of free fatty acids and arginine

22M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L79(2018)10–23

on growth hormone secretion in man.Metab Clin Exp1994;

43(2):223–6.

[53]Alba-Roth J,Muller OA,Schopohl J,von Werder K.Arginine

stimulates growth hormone secretion by suppressing en-

dogenous somatostatin secretion.J Clin Endocrinol Metab

1988;67(6):1186–9.

[54]Marostica E,Grugni G,De Nicolao G,Marazzi N,Crino A,

Cappa M,et al.The GHRH+arginine stimulated pituitary GH secretion in children and adults with Prader-Willi syndrome shows age-and BMI-dependent and genotype-related differ-ences.Growth Horm IGF Res2013;23(6):261–6.

[55]Pimentel GD,Ganeshan K,Carvalheira JB.Hypothalamic

inflammation and the central nervous system control of

energy homeostasis.Mol Cell Endocrinol2014;397(1–2):15–22.

[56]Bourdeau A,Dube N,Tremblay ML.Cytoplasmic protein

tyrosine phosphatases,regulation and function:the roles of PTP1B and TC-PTP.Curr Opin Cell Biol2005;17(2):203–9. [57]Bansal V,Ochoa JB.Arginine availability,arginase,and the

immune response.Curr Opin Clin Nutr Metab Care2003;6(2): 223–8.

[58]Efron DT,Barbul A.Modulation of inflammation and immu-

nity by arginine supplements.Curr Opin Clin Nutr Metab

Care1998;1(6):531–8.

[59]Wu T,Wang C,Ding L,Shen Y,Cui H,Wang M,et al.Arginine

relieves the inflammatory response and enhances the

casein expression in bovine mammary epithelial cells

induced by lipopolysaccharide.Mediators Inflamm2016;

2016:9618795.

[60]Savar NS,Bouzari S.In silico study of ligand binding site of

toll-like receptor5.Adv Biomed Res2014;3:41.

[61]Lester SN,Li K.Toll-like receptors in antiviral innate

immunity.J Mol Biol2014;426(6):1246–64.

[62]Huang NQ,Jin H,Zhou SY,Shi JS,Jin F.TLR4is a link between

diabetes and Alzheimer's disease.Behav Brain Res2017;316:234–44.

[63]Jia SJ,Niu PP,Cong JZ,Zhang BK,Zhao M.TLR4signaling:a

potential therapeutic target in ischemic coronary artery

disease.Int Immunopharmacol2014;23(1):54–9.

[64]Ozturk A,Vieira AR.TLR4as a risk factor for

periodontal disease:a reappraisal.J Clin Periodontol2009;

36(4):279–86.

[65]Rahimifard M,Maqbool F,Moeini-Nodeh S,Niaz K,Abdollahi

M,Braidy N,et al.Targeting the TLR4signaling pathway by polyphenols:a novel therapeutic strategy for neuroinflam-mation.Ageing Res Rev2017;36:11–9.

[66]Fukata M,Abreu MT.TLR4signalling in the intestine in health

and disease.Biochem Soc Trans2007;35(Pt6):1473–8.

[67]Chen Y,Chen D,Tian G,He J,Mao X,Mao Q,et al.Dietary

arginine supplementation alleviates immune challenge

induced by Salmonella enterica serovar Choleraesuis bacterin potentially through the toll-like receptor4-myeloid

differentiation factor88signalling pathway in weaned

piglets.Br J Nutr2012;108(6):1069–76.

23

M E T A B O L I S M C L I N I C A L A N D E X P E R I M E N T A L79(2018)10–23

Appendix A. Supplemental Methods

Animal Studies

In the long-term feeding experiment, twenty-four 5-week-old mice were randomly divided into two groups and raised for 5 weeks. 1.5% Arg or equimolar Ala were supplemented via drinking water. Body weight, food intake and water intake were checked every week. Body composition was measured by MesoQMR23-060H (Niumag Co. Ltd., Shanghai, China) at the end of this experiment.

Serum Free IGF-1 and GH Detection

The serum free IGF-1 concentration was detected by RIA without any treatment of serum. The GH secretion was detected by ELISA kit according to the manufacturer’s recommendation. The ELISA kit was purchased from Mskbio Co., Ltd. (Wuhan, China).

Appendix B. Supplemental Figures

Fig. S1 Arg have no effect on growth or body composition of chow diet fed mice (relate to Fig. 1). Twenty-four 5-week-old mice were randomly divided into two groups (n=12) and raised for 5 weeks. 1.5% Arg or equimolar Ala were supplemented via drinking water. (A) Body weight, (B) Body weight gain, (C) Water intake, (D) Food intake and (E) Accumulative food intake were recorded every week. (F) mass/body weight ratio detected by QMR at the last week. Data are presented as mean ± SEM.

Fig. S2 Arg ameliorates CR induced body weight loss but have no effect on body composition (relate to Fig. 1). Twenty-four 12-week-old mice were randomly divided into two groups (n=12) and given diet of approximate 60% average daily food intake for

18 days. 0% or 1.5% Arg were supplemented via drinking water. (A) Mice body weight.

(B) mass/body weight ratio detected by QMR at the last day. Data are presented as mean ± SEM. * means P<0.05 compared with the control.

Fig. S3 The effects of Arg on hepatic IGF-1 expression and expression (relate to Fig. 1). HepG2 cells were exposed to different concentrations (0, 0.2, 0.5 and 1 mM) of Arg for 24 h. (A-B) Expression level of IGF-1 by detected Western Blot. Twelve 6-week-old mice were divided into two groups (n=6) and injected with saline or 1.6 g/kg Arg for 1 h. (C) Serum free IGF-1 concentration detected by ELISA kit. (D) Twelve 6-week-old mice were divided into two groups (n=6) and injected with saline or 1.6 g/kg Arg for 1 h under fed condition (morning). Serum total IGF-1 concentration detected by RIA. Data are presented as mean ± SEM. Significant differences between the control and the treated group were determined by Student’s t test. * means P<0.05 compared with the control. One-way ANOVA with post hoc Tukey test was used to test the dosage effect of Arg. GAPDH served as a housekeeping gene.

Fig. S4 The role of mTOR in Arg-induced IGF-1 expression in HepG2 cells (relate to Fig. 2). HepG2 cells were exposed to mTOR inhibitor rapamycin (1 μM) or co-treated with Arg (1 mM) for 24 h. (A-B) Phosphorylation level of S6 and expression level of IGF-1 detected by Western Blot. Data are presented as mean ± SEM. * and # means P<0.05 compared with the control and Rap. group, respectively. GAPDH served as a housekeeping gene.

Fig. S5 Arg reduces expression of pro-inflammatory factors and combination between JAK2 and PTP1B (relate to Fig. 5). HepG2 cells were exposed to 0 mM or 1mM Arg for 24 h. (A) Relative mRNA expression levels detected by qPCR. (B) Combination between hepatic JAK2 and PTP1B or SOCS3 detected by co-IP. Data are presented as mean ± SEM. * means P<0.05 compared with the control. GAPDH served as a housekeeping gene.